ID: 1138207343

View in Genome Browser
Species Human (GRCh38)
Location 16:55134578-55134600
Sequence CAGCTCTCACCTGGGGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138207343_1138207353 19 Left 1138207343 16:55134578-55134600 CCCTGAGCCCCAGGTGAGAGCTG No data
Right 1138207353 16:55134620-55134642 GATTTCAGCTGGTGAGACCCTGG No data
1138207343_1138207354 20 Left 1138207343 16:55134578-55134600 CCCTGAGCCCCAGGTGAGAGCTG No data
Right 1138207354 16:55134621-55134643 ATTTCAGCTGGTGAGACCCTGGG No data
1138207343_1138207351 8 Left 1138207343 16:55134578-55134600 CCCTGAGCCCCAGGTGAGAGCTG No data
Right 1138207351 16:55134609-55134631 GCCAACAACTTGATTTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138207343 Original CRISPR CAGCTCTCACCTGGGGCTCA GGG (reversed) Intergenic