ID: 1138207499

View in Genome Browser
Species Human (GRCh38)
Location 16:55135510-55135532
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138207495_1138207499 7 Left 1138207495 16:55135480-55135502 CCTTGTCAGGCCTAATGGAGAAG No data
Right 1138207499 16:55135510-55135532 GCTCCCATCAAGCTGTAGGGAGG No data
1138207491_1138207499 12 Left 1138207491 16:55135475-55135497 CCTCCCCTTGTCAGGCCTAATGG No data
Right 1138207499 16:55135510-55135532 GCTCCCATCAAGCTGTAGGGAGG No data
1138207496_1138207499 -3 Left 1138207496 16:55135490-55135512 CCTAATGGAGAAGAAAAACAGCT No data
Right 1138207499 16:55135510-55135532 GCTCCCATCAAGCTGTAGGGAGG No data
1138207493_1138207499 9 Left 1138207493 16:55135478-55135500 CCCCTTGTCAGGCCTAATGGAGA No data
Right 1138207499 16:55135510-55135532 GCTCCCATCAAGCTGTAGGGAGG No data
1138207494_1138207499 8 Left 1138207494 16:55135479-55135501 CCCTTGTCAGGCCTAATGGAGAA No data
Right 1138207499 16:55135510-55135532 GCTCCCATCAAGCTGTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138207499 Original CRISPR GCTCCCATCAAGCTGTAGGG AGG Intergenic