ID: 1138211375

View in Genome Browser
Species Human (GRCh38)
Location 16:55166057-55166079
Sequence CTATGCAGACAGCTGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138211375_1138211384 25 Left 1138211375 16:55166057-55166079 CCTTCCCCCAGCTGTCTGCATAG No data
Right 1138211384 16:55166105-55166127 TGCTCAATGCAGCCCACTTAGGG No data
1138211375_1138211381 -3 Left 1138211375 16:55166057-55166079 CCTTCCCCCAGCTGTCTGCATAG No data
Right 1138211381 16:55166077-55166099 TAGATTCTTACTCATCTGGCTGG No data
1138211375_1138211383 24 Left 1138211375 16:55166057-55166079 CCTTCCCCCAGCTGTCTGCATAG No data
Right 1138211383 16:55166104-55166126 TTGCTCAATGCAGCCCACTTAGG No data
1138211375_1138211380 -7 Left 1138211375 16:55166057-55166079 CCTTCCCCCAGCTGTCTGCATAG No data
Right 1138211380 16:55166073-55166095 TGCATAGATTCTTACTCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138211375 Original CRISPR CTATGCAGACAGCTGGGGGA AGG (reversed) Intergenic
No off target data available for this crispr