ID: 1138218523

View in Genome Browser
Species Human (GRCh38)
Location 16:55227273-55227295
Sequence TGTGAGATAATGCTGCTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138218518_1138218523 7 Left 1138218518 16:55227243-55227265 CCCTTTTGGGATACAGTGTGTTA No data
Right 1138218523 16:55227273-55227295 TGTGAGATAATGCTGCTTGAGGG No data
1138218516_1138218523 11 Left 1138218516 16:55227239-55227261 CCCACCCTTTTGGGATACAGTGT No data
Right 1138218523 16:55227273-55227295 TGTGAGATAATGCTGCTTGAGGG No data
1138218519_1138218523 6 Left 1138218519 16:55227244-55227266 CCTTTTGGGATACAGTGTGTTAT No data
Right 1138218523 16:55227273-55227295 TGTGAGATAATGCTGCTTGAGGG No data
1138218517_1138218523 10 Left 1138218517 16:55227240-55227262 CCACCCTTTTGGGATACAGTGTG No data
Right 1138218523 16:55227273-55227295 TGTGAGATAATGCTGCTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138218523 Original CRISPR TGTGAGATAATGCTGCTTGA GGG Intergenic
No off target data available for this crispr