ID: 1138223766

View in Genome Browser
Species Human (GRCh38)
Location 16:55275305-55275327
Sequence CTTCTGAAGTCAGACAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138223766_1138223771 23 Left 1138223766 16:55275305-55275327 CCAGGCCTGTCTGACTTCAGAAG No data
Right 1138223771 16:55275351-55275373 CCACGGTTCAAAAAATACAAAGG No data
1138223766_1138223769 6 Left 1138223766 16:55275305-55275327 CCAGGCCTGTCTGACTTCAGAAG No data
Right 1138223769 16:55275334-55275356 TCATAACTGCTGCTGCTCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138223766 Original CRISPR CTTCTGAAGTCAGACAGGCC TGG (reversed) Intergenic
No off target data available for this crispr