ID: 1138224205

View in Genome Browser
Species Human (GRCh38)
Location 16:55278652-55278674
Sequence CAGAATGGTTAGAGGAAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138224200_1138224205 7 Left 1138224200 16:55278622-55278644 CCTCTGATTGAACATAAACTTGG No data
Right 1138224205 16:55278652-55278674 CAGAATGGTTAGAGGAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138224205 Original CRISPR CAGAATGGTTAGAGGAAGTC TGG Intergenic
No off target data available for this crispr