ID: 1138224962

View in Genome Browser
Species Human (GRCh38)
Location 16:55285217-55285239
Sequence GGGATCCTTCCCTTCTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138224962_1138224972 20 Left 1138224962 16:55285217-55285239 CCCCCAGAGAAGGGAAGGATCCC No data
Right 1138224972 16:55285260-55285282 CTGTTCCTGGGTTGATACCAGGG No data
1138224962_1138224969 7 Left 1138224962 16:55285217-55285239 CCCCCAGAGAAGGGAAGGATCCC No data
Right 1138224969 16:55285247-55285269 AATCTCTGTGGCTCTGTTCCTGG No data
1138224962_1138224966 -5 Left 1138224962 16:55285217-55285239 CCCCCAGAGAAGGGAAGGATCCC No data
Right 1138224966 16:55285235-55285257 ATCCCAGAGAAGAATCTCTGTGG No data
1138224962_1138224970 8 Left 1138224962 16:55285217-55285239 CCCCCAGAGAAGGGAAGGATCCC No data
Right 1138224970 16:55285248-55285270 ATCTCTGTGGCTCTGTTCCTGGG No data
1138224962_1138224971 19 Left 1138224962 16:55285217-55285239 CCCCCAGAGAAGGGAAGGATCCC No data
Right 1138224971 16:55285259-55285281 TCTGTTCCTGGGTTGATACCAGG No data
1138224962_1138224973 23 Left 1138224962 16:55285217-55285239 CCCCCAGAGAAGGGAAGGATCCC No data
Right 1138224973 16:55285263-55285285 TTCCTGGGTTGATACCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138224962 Original CRISPR GGGATCCTTCCCTTCTCTGG GGG (reversed) Intergenic
No off target data available for this crispr