ID: 1138228671

View in Genome Browser
Species Human (GRCh38)
Location 16:55322684-55322706
Sequence CTATCCACACATTTGCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138228671_1138228673 5 Left 1138228671 16:55322684-55322706 CCAAGCTGCAAATGTGTGGATAG No data
Right 1138228673 16:55322712-55322734 AAGTGCATTTTGAAAAATCAAGG No data
1138228671_1138228674 6 Left 1138228671 16:55322684-55322706 CCAAGCTGCAAATGTGTGGATAG No data
Right 1138228674 16:55322713-55322735 AGTGCATTTTGAAAAATCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138228671 Original CRISPR CTATCCACACATTTGCAGCT TGG (reversed) Intergenic
No off target data available for this crispr