ID: 1138229076

View in Genome Browser
Species Human (GRCh38)
Location 16:55324624-55324646
Sequence GAGAGTGCGCGCGCGCGCAC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 157}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138229074_1138229076 0 Left 1138229074 16:55324601-55324623 CCGGAGCAAGTGTGAGTGTGGGT 0: 1
1: 0
2: 3
3: 37
4: 351
Right 1138229076 16:55324624-55324646 GAGAGTGCGCGCGCGCGCACGGG 0: 1
1: 0
2: 2
3: 22
4: 157
1138229072_1138229076 1 Left 1138229072 16:55324600-55324622 CCCGGAGCAAGTGTGAGTGTGGG 0: 1
1: 0
2: 2
3: 41
4: 352
Right 1138229076 16:55324624-55324646 GAGAGTGCGCGCGCGCGCACGGG 0: 1
1: 0
2: 2
3: 22
4: 157
1138229069_1138229076 17 Left 1138229069 16:55324584-55324606 CCAGCTGCACAAACCTCCCGGAG 0: 1
1: 0
2: 1
3: 29
4: 258
Right 1138229076 16:55324624-55324646 GAGAGTGCGCGCGCGCGCACGGG 0: 1
1: 0
2: 2
3: 22
4: 157
1138229067_1138229076 22 Left 1138229067 16:55324579-55324601 CCTCGCCAGCTGCACAAACCTCC 0: 1
1: 0
2: 2
3: 13
4: 184
Right 1138229076 16:55324624-55324646 GAGAGTGCGCGCGCGCGCACGGG 0: 1
1: 0
2: 2
3: 22
4: 157
1138229070_1138229076 4 Left 1138229070 16:55324597-55324619 CCTCCCGGAGCAAGTGTGAGTGT 0: 1
1: 0
2: 0
3: 6
4: 105
Right 1138229076 16:55324624-55324646 GAGAGTGCGCGCGCGCGCACGGG 0: 1
1: 0
2: 2
3: 22
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138229076 Original CRISPR GAGAGTGCGCGCGCGCGCAC GGG Exonic