ID: 1138229076

View in Genome Browser
Species Human (GRCh38)
Location 16:55324624-55324646
Sequence GAGAGTGCGCGCGCGCGCAC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 157}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138229074_1138229076 0 Left 1138229074 16:55324601-55324623 CCGGAGCAAGTGTGAGTGTGGGT 0: 1
1: 0
2: 3
3: 37
4: 351
Right 1138229076 16:55324624-55324646 GAGAGTGCGCGCGCGCGCACGGG 0: 1
1: 0
2: 2
3: 22
4: 157
1138229069_1138229076 17 Left 1138229069 16:55324584-55324606 CCAGCTGCACAAACCTCCCGGAG 0: 1
1: 0
2: 1
3: 29
4: 258
Right 1138229076 16:55324624-55324646 GAGAGTGCGCGCGCGCGCACGGG 0: 1
1: 0
2: 2
3: 22
4: 157
1138229070_1138229076 4 Left 1138229070 16:55324597-55324619 CCTCCCGGAGCAAGTGTGAGTGT 0: 1
1: 0
2: 0
3: 6
4: 105
Right 1138229076 16:55324624-55324646 GAGAGTGCGCGCGCGCGCACGGG 0: 1
1: 0
2: 2
3: 22
4: 157
1138229072_1138229076 1 Left 1138229072 16:55324600-55324622 CCCGGAGCAAGTGTGAGTGTGGG 0: 1
1: 0
2: 2
3: 41
4: 352
Right 1138229076 16:55324624-55324646 GAGAGTGCGCGCGCGCGCACGGG 0: 1
1: 0
2: 2
3: 22
4: 157
1138229067_1138229076 22 Left 1138229067 16:55324579-55324601 CCTCGCCAGCTGCACAAACCTCC 0: 1
1: 0
2: 2
3: 13
4: 184
Right 1138229076 16:55324624-55324646 GAGAGTGCGCGCGCGCGCACGGG 0: 1
1: 0
2: 2
3: 22
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138229076 Original CRISPR GAGAGTGCGCGCGCGCGCAC GGG Exonic
900580927 1:3408490-3408512 GTGAGTGTGGGCGCGTGCACCGG + Intronic
901636191 1:10671319-10671341 GAGCGTGTGTGCGCGCGCACAGG - Intronic
903614740 1:24643514-24643536 GAGACTGCGCAGGGGCGCACCGG - Intronic
907118314 1:51989092-51989114 GTGTGTGTGTGCGCGCGCACAGG - Intronic
907526476 1:55056863-55056885 GTGCGTGCGCGCGCGCGCGTTGG + Intronic
908688619 1:66752469-66752491 GAGAGTGCGCGGGCGGCCGCCGG + Exonic
914869118 1:151458807-151458829 GAGTGCGCGCGCGCGCGCCGCGG + Intronic
919930009 1:202215015-202215037 GTGTGTGCGCGCGCGCGCGTTGG + Intronic
920524997 1:206659793-206659815 GTGTGTGCGCGCGCACGCACCGG - Intronic
920857695 1:209676067-209676089 GACAGAGGGGGCGCGCGCACAGG + Exonic
922817256 1:228458676-228458698 GTGTGTGTGCGCGCGCGCGCCGG + Exonic
1063624806 10:7679009-7679031 GTGTGTGCGCGCGCGCGCGGAGG - Intergenic
1068301211 10:55143070-55143092 GAGAGCGCGAGCGCGAGCAGGGG - Intronic
1068301213 10:55143072-55143094 GAGAGAGCGCGAGCGCGAGCAGG - Intronic
1073326219 10:102645196-102645218 GTGTGTGCGCGCGCGCGCGTAGG - Intronic
1073463755 10:103681757-103681779 GTGTGTGCGCGCGCGCGCGCGGG - Intronic
1074251148 10:111749267-111749289 GAGAGAGAGCGAGCGAGCACTGG - Intergenic
1083256184 11:61496715-61496737 GAGAGTGCGAGCGCGCTCACGGG - Intergenic
1083317871 11:61827724-61827746 GGGCGTGCGCGCACGCGCCCCGG + Intronic
1087953859 11:104259065-104259087 GAGAGTGAGAGAGCGCTCACTGG - Intergenic
1091023852 11:132124617-132124639 GTGTGTGCGCGCGCACGCGCAGG + Intronic
1092655044 12:10674872-10674894 GTGCGCGCGCGCGCGCGCGCGGG - Intergenic
1092899369 12:13044371-13044393 GCGGGCGCGCGCACGCGCACCGG + Exonic
1093547839 12:20369205-20369227 GTGTGTGCGCGCGCGCGCGTGGG + Intergenic
1094041710 12:26126101-26126123 GGGCGAGCGCGCGCGCGCACGGG - Intronic
1096101298 12:48971836-48971858 GCGCGCGCGCGCGCGCGCGCTGG - Intergenic
1096242677 12:49967674-49967696 GTGTGTGCGCGCGTGTGCACGGG - Intronic
1096481107 12:51941569-51941591 GTGTGTGCGCGCGCGCGCGTGGG - Intergenic
1096482447 12:51951678-51951700 GGGGGCGCGCGCGCGCGCGCTGG + Intronic
1097218365 12:57431153-57431175 GCGAGTGCGCGCGCGCCGGCGGG - Intergenic
1098350782 12:69557618-69557640 GTGCGCGCGCGCGCGCGCGCAGG + Intronic
1103800359 12:123533755-123533777 GGGAGGGCGCGCGCGTGCGCAGG + Intergenic
1106735670 13:32586290-32586312 GGACGTGCGCGCGCGCGGACGGG + Intergenic
1107459236 13:40585330-40585352 GTGTGTGTGCGCGCGCGCAGAGG - Intronic
1107770929 13:43786979-43787001 ATGGGTGCGCGCGCGCCCACGGG + Intergenic
1108408083 13:50124567-50124589 GAGAGCGCGCGCGCGGGCTTCGG - Intronic
1110922491 13:81106116-81106138 GTGTGCGCGCGTGCGCGCACAGG - Intergenic
1112507038 13:99981591-99981613 GAGTGTGTGCGTGCGCGCGCGGG + Intergenic
1112508764 13:99990827-99990849 GTGTGTGTGCGCGCGCGCAAAGG - Intergenic
1113517387 13:110914378-110914400 GCGCGCGCGCGCGCTCGCACAGG + Intronic
1118323157 14:64765036-64765058 GTGTGTGCGCGCGCGCGCGCGGG + Intronic
1120834582 14:89028021-89028043 GTGTGCGCGCGCGCGCGGACAGG - Intergenic
1122265916 14:100546761-100546783 GTGCGCGCGCGCGCGCGCGCCGG - Intronic
1122544820 14:102516680-102516702 TAGAGGGCGCGCCCGCGCACTGG - Intergenic
1122630449 14:103105148-103105170 GGGAGTGCGCGCGCGTGGAGGGG + Intronic
1123004400 14:105314504-105314526 GAGTGCGCGCTCTCGCGCACCGG + Exonic
1123037979 14:105479048-105479070 GTGAGTGCGCGCCCGGGCCCCGG + Intronic
1123716815 15:23039643-23039665 GAGAGTTCGCGCTCCCGCGCCGG + Exonic
1125201017 15:37100746-37100768 GCGCGCGCGCGCGCGCGAACAGG + Intronic
1125698598 15:41660407-41660429 AAGAGCCTGCGCGCGCGCACCGG - Exonic
1128791140 15:70434715-70434737 GTGTGCGCGCGCGCGCGCGCGGG - Intergenic
1129644848 15:77420259-77420281 GTGAGCACGCGCGCGCTCACGGG + Intergenic
1135037738 16:19092171-19092193 GTGTGTGTGCGCGCGCGCATTGG + Intergenic
1138229076 16:55324624-55324646 GAGAGTGCGCGCGCGCGCACGGG + Exonic
1138478204 16:57284381-57284403 GAGAGCACGCGCGGGCCCACGGG - Intronic
1141647277 16:85374540-85374562 GTGTGCGCGCGCGCGTGCACAGG + Intergenic
1142810571 17:2393846-2393868 GGGAGGGCGCGCGTGCGCAGAGG - Intronic
1143102603 17:4512638-4512660 GTGTGTGCGTGCGCGCGCACGGG + Intronic
1143172840 17:4939939-4939961 GAGCGGGGCCGCGCGCGCACGGG - Exonic
1144172835 17:12676230-12676252 GTGTGTGCGTGCGCGCGCAGGGG - Intronic
1147139487 17:38453453-38453475 GTGTGTGTGCGCGCGCGCGCTGG + Intronic
1148388681 17:47254380-47254402 GTGAGAGCGTGCGCGCGCGCGGG + Intronic
1148563406 17:48619262-48619284 GTGTGTGTGCGCGCGCGCGCAGG + Intronic
1150643390 17:66964402-66964424 GAGAGAGCGCGCGCGGGCGCGGG + Intergenic
1151933401 17:77247205-77247227 GAGTGTGCGCGTCTGCGCACCGG + Intergenic
1152689663 17:81712269-81712291 GCCAATGCGCGCGCGCGCCCCGG - Intronic
1152745609 17:82037305-82037327 GAGAGGGTGCGCGGGCGCCCAGG + Intronic
1153457515 18:5296220-5296242 GCGCGTGCGCGCGCGTGCGCAGG - Intronic
1154940912 18:21111858-21111880 CAGAGTGCGCGCGCGCGCGCGGG - Intergenic
1154954287 18:21240562-21240584 GTGTGTGCGCGCGCGCGCGCGGG - Intergenic
1157279280 18:46335090-46335112 GCGAGTGTGCGCGCGCGCCTCGG + Intronic
1158931215 18:62325972-62325994 GAGAGACTGCGCGCGCGCCCCGG + Intronic
1158931217 18:62325974-62325996 GAGACTGCGCGCGCGCCCCGGGG + Intronic
1159102470 18:63971155-63971177 GGGAGAGCGCGCGCGCGAAACGG - Intronic
1160714976 19:572462-572484 GAGCGTGTGCGCGCGTGCGCAGG + Intronic
1163804128 19:19385920-19385942 GGGGGTGCGCGTGCGCGCGCCGG - Exonic
1164498735 19:28793786-28793808 GAGGCTGCTCGCGCGCGCCCGGG - Intergenic
1168336527 19:55600362-55600384 GCGAGTGTGCGCGCGCGCGGGGG - Intronic
925532254 2:4877115-4877137 GTGTGTGCGCGCGCGCGCCTGGG - Intergenic
927000873 2:18792942-18792964 GTGTGTGCACGCGCGCGCAGTGG - Intergenic
928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG + Intronic
929313280 2:40450364-40450386 GTGTGTGCACGCGCGCGCGCTGG + Intronic
929313571 2:40452155-40452177 GGGGGAGCGCGCGCGCGCCCGGG - Intronic
930872694 2:56184420-56184442 GGGAGCGCGGGCGCGCGCGCGGG + Exonic
931649374 2:64454398-64454420 GGGCGCGCGCGCGCGCGCCCGGG - Exonic
932625674 2:73293758-73293780 GGGAGCGCGCGCGCACGCAGCGG - Intergenic
932956346 2:76356098-76356120 GAGAGAGAGCGCGCACACACAGG - Intergenic
933817235 2:86077796-86077818 GTGTGTGCGCGCGCGCGTGCAGG - Intronic
934897219 2:98129374-98129396 GAGAGTGAGGGCGCACTCACTGG + Intronic
935595359 2:104873518-104873540 GTGAGTGCGAGTGCGCGCGCGGG - Intergenic
938301141 2:130213745-130213767 GAGAGGGCGCGGGCGCCCAGTGG - Intergenic
938537522 2:132257823-132257845 GGGATTGCGCGCACGCGCAGCGG - Intronic
938900482 2:135795030-135795052 GTGTGTGCGCGCGCGCGCGTGGG - Intronic
942034728 2:171999843-171999865 GGGAGCGCGCGTGCGCGCGCGGG - Exonic
945033359 2:205684939-205684961 GTGTGTGCGCGCTCGCGCGCTGG - Intronic
945699439 2:213151849-213151871 GCGCGTGTGCGCGCGCGCGCGGG + Intronic
947625290 2:231614816-231614838 GTGCGTGCGCGCGCGCGCGCGGG - Intergenic
1173807494 20:45935192-45935214 GTGCGCGCGCGCGCGCGCGCTGG + Intronic
1174054190 20:47786539-47786561 GGGAGTTCTCGGGCGCGCACAGG - Exonic
1177077011 21:16588641-16588663 GCGAGCACGCGCGCGCACACAGG - Intergenic
1179569250 21:42268381-42268403 GTGTGTGTGCGCGCGCGCGCTGG + Intronic
1181069257 22:20322341-20322363 GTGTGTGCGCGCGCGCACAATGG - Intergenic
1181401507 22:22652835-22652857 GTGTGTGCGCGCACGTGCACTGG + Intergenic
1181574892 22:23787365-23787387 GGGCGCGCGCGCGCGCGCTCGGG + Intronic
1182737661 22:32542646-32542668 GTGTGTGTGCGCGCGCACACAGG + Intronic
1185285918 22:49999809-49999831 GCGAGTGAGCGCCCGCGCCCCGG - Exonic
951558860 3:23946027-23946049 GGGGGCGCGCGCGCGCGCGCTGG + Intronic
953631993 3:44625733-44625755 GTGTGCGCGCGCGCGCGCAAAGG - Intronic
954256661 3:49412060-49412082 GTGAGTGCGCGCGCGTGCGCGGG - Exonic
957792910 3:84961632-84961654 GTGTGTGCGCGCGCGCGCGCCGG + Intronic
964518859 3:157542597-157542619 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
966593007 3:181702020-181702042 GTGTGTGCGCGCGCGCGCATGGG - Intergenic
967271749 3:187738540-187738562 GAGAGTGCCAGTGCGCGCGCAGG - Intronic
967858506 3:194135026-194135048 GAGTGTGTGTGCGCGCGCCCCGG - Intergenic
968584072 4:1407844-1407866 GAGCGCGCGGGCGCGTGCACCGG + Intergenic
968879833 4:3293165-3293187 GAGGGCGCGGGCGCGCGCCCCGG - Intronic
969053605 4:4388278-4388300 GAGGGTGTGCGCGCTCACACAGG + Intronic
969362546 4:6673940-6673962 GCAAGTGCGCGTGCGCGCGCAGG + Intergenic
969362630 4:6674319-6674341 GCGAGCGCGCCCGGGCGCACTGG + Intergenic
970826545 4:20283105-20283127 GTGTGTGCGCGCGCGCACACAGG - Intronic
976897466 4:90128515-90128537 GTGCGCGCGCGCGCGCGCTCTGG + Intronic
985513027 5:322518-322540 GAGAGCCTGTGCGCGCGCACAGG - Intronic
986976028 5:13395018-13395040 GTGTGCACGCGCGCGCGCACTGG - Intergenic
986976034 5:13395105-13395127 GTGTGCGCGCGCGCGTGCACTGG - Intergenic
986976046 5:13395291-13395313 GCGCGCGCGCACGCGCGCACTGG - Intergenic
987901085 5:24013042-24013064 GTGTGTGTGCGCGCGCGCGCAGG + Intronic
990527260 5:56640229-56640251 GAGAGAGAGAGCGCGCACACAGG - Intergenic
992286112 5:75236993-75237015 GAGGCCGCGCGCGCGCGCGCAGG + Intergenic
993501930 5:88674931-88674953 GCGTGTGCGTGCCCGCGCACCGG - Intergenic
995607753 5:113875846-113875868 GAGAGAGAGAGCGCGCGCAATGG - Intergenic
997459874 5:134044655-134044677 GTGTGTGTGCGCGCGCGCACAGG + Intergenic
997899844 5:137754365-137754387 GAGGGTGCGCGCGCGTTCAGCGG - Exonic
998131267 5:139652145-139652167 GCGCGCGCGCGCGCGCGCGCCGG - Intronic
998151355 5:139759287-139759309 GAGAGAGCGCGCGCGGGCGGTGG - Intergenic
1000220537 5:159209619-159209641 GAGTGAGCGCGGGCGCGCGCGGG - Intronic
1002058834 5:176614168-176614190 GTGTGTGTGCGCGCGCGCAGGGG - Intergenic
1002591047 5:180291875-180291897 GAGAGGGCGGGCGGGCGGACTGG + Exonic
1004241388 6:13925175-13925197 GAGACTCCGCGCGCGGGCCCCGG - Intronic
1005303747 6:24494944-24494966 GCAAGCGGGCGCGCGCGCACGGG - Intronic
1006271987 6:32972082-32972104 GAGCGAGCGCGCGCGCGCGGAGG + Exonic
1006271989 6:32972084-32972106 GCGAGCGCGCGCGCGCGGAGGGG + Exonic
1011277200 6:85642968-85642990 GCGGGGGCGCGCGCGCGCACCGG - Exonic
1013369108 6:109455059-109455081 GAGAGCGCGCCCGGGCGCACAGG - Intronic
1014109283 6:117602370-117602392 GAGTGTGCCCGCGCGCGCGGGGG - Intronic
1014632355 6:123803245-123803267 GTGTGTGTGCGCGCGCGCTCGGG - Intergenic
1015605153 6:134946772-134946794 GCATGTGTGCGCGCGCGCACAGG + Intronic
1017163830 6:151390435-151390457 GCGAGCGCGCGCGCGCACGCGGG - Intronic
1017175081 6:151494720-151494742 GTGTGTGTGCGCGCGCGCATTGG - Intronic
1018154441 6:160972777-160972799 GTGCGTGCGCGTGCGCGCAATGG - Intergenic
1021107625 7:16656540-16656562 GTGTGTGCGCGCGCGCGCTGGGG - Intronic
1021107627 7:16656542-16656564 GTGTGTGTGCGCGCGCGCGCTGG - Intronic
1022230750 7:28410064-28410086 GCGGGTGGGCGCGCGCGCAGGGG + Intronic
1023447680 7:40248869-40248891 GTGCGAGCGCGCGCGCGCGCTGG - Intronic
1028964412 7:96786318-96786340 GTGTGTGCGCGCGCACACACAGG + Intergenic
1029449595 7:100633393-100633415 GTGAGTGCGCGCGCGGGCGGGGG - Intronic
1029672778 7:102045427-102045449 GAGGGGGCGCGCGGGCGCAGTGG - Intronic
1031213281 7:118858667-118858689 GAGCGCGCGCGCGCGCGCGTGGG - Intergenic
1032013413 7:128360972-128360994 GTGTGTGCGCGCGCGCGTGCAGG - Intronic
1032027566 7:128455805-128455827 GAGGGTACGCGCACGCGCACTGG - Intergenic
1037900476 8:22685425-22685447 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
1038028036 8:23609669-23609691 GAGAGTGAGCGAGCGAGCTCTGG + Intergenic
1038554012 8:28494155-28494177 ACGAGCGCGCGCGCACGCACGGG - Intergenic
1043515179 8:80989524-80989546 GAGAGAGCGCGAGCACACACAGG - Intronic
1044301660 8:90591360-90591382 GAGAGAGAGCGCGCGCGCAAAGG - Intergenic
1044906702 8:97011934-97011956 GAGAGAGAGAGCGCGCACACTGG - Intronic
1045287780 8:100806878-100806900 GTGTGTGCGCGCGCACGCACAGG + Intergenic
1047423567 8:124727081-124727103 GTGTGTGCGCGCGCGCGCGTGGG - Intronic
1049773537 8:144394570-144394592 GAGGGTGAGCGGGCGCGGACGGG + Intronic
1050437853 9:5628956-5628978 GAGGGCCCGCGCGCGCGCTCTGG - Intergenic
1054842662 9:69760012-69760034 GAGCGCGCGCGCGCGCGCGCGGG + Intergenic
1055397632 9:75891512-75891534 GTGCGTACGCGCGCGCGCGCAGG - Intronic
1058602538 9:106685482-106685504 ACGCGCGCGCGCGCGCGCACAGG - Intergenic
1059191807 9:112333746-112333768 GAGGGTGGGCGCGAGCGCAGGGG - Intergenic
1060463867 9:123884982-123885004 GTGTGTGCGCGCGCGCTCGCAGG - Intronic
1062341433 9:136095379-136095401 GGCCGCGCGCGCGCGCGCACTGG + Intergenic
1062527824 9:136985398-136985420 GGGAGAGCGCGCCCGCACACTGG - Exonic
1186490596 X:9969424-9969446 GTGTGTGTGCGCGCGTGCACTGG - Intergenic
1187487990 X:19722548-19722570 GTGTGTGTGCGCGTGCGCACTGG + Intronic
1188095865 X:26020644-26020666 GTGTGTGCGCGCGCGTGCATGGG - Intergenic
1194035534 X:88866236-88866258 GTGTGTGTGCGCGCGCGCAAAGG + Intergenic
1196893190 X:120309779-120309801 AAGAGTGCGCGCGCGCGAGCTGG + Intronic
1201076823 Y:10195632-10195654 GGGATTGCGCGCACGCGCAGTGG + Intergenic