ID: 1138230239

View in Genome Browser
Species Human (GRCh38)
Location 16:55331206-55331228
Sequence TCCCATTGGTTGGCCTGTAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138230239_1138230248 -3 Left 1138230239 16:55331206-55331228 CCGGTACAGGCCAACCAATGGGA No data
Right 1138230248 16:55331226-55331248 GGAACTGACGGGCAGGGAAGGGG No data
1138230239_1138230247 -4 Left 1138230239 16:55331206-55331228 CCGGTACAGGCCAACCAATGGGA No data
Right 1138230247 16:55331225-55331247 GGGAACTGACGGGCAGGGAAGGG No data
1138230239_1138230246 -5 Left 1138230239 16:55331206-55331228 CCGGTACAGGCCAACCAATGGGA No data
Right 1138230246 16:55331224-55331246 TGGGAACTGACGGGCAGGGAAGG No data
1138230239_1138230243 -10 Left 1138230239 16:55331206-55331228 CCGGTACAGGCCAACCAATGGGA No data
Right 1138230243 16:55331219-55331241 ACCAATGGGAACTGACGGGCAGG No data
1138230239_1138230245 -9 Left 1138230239 16:55331206-55331228 CCGGTACAGGCCAACCAATGGGA No data
Right 1138230245 16:55331220-55331242 CCAATGGGAACTGACGGGCAGGG No data
1138230239_1138230249 17 Left 1138230239 16:55331206-55331228 CCGGTACAGGCCAACCAATGGGA No data
Right 1138230249 16:55331246-55331268 GGGTCTTTGTCCCCCTTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138230239 Original CRISPR TCCCATTGGTTGGCCTGTAC CGG (reversed) Intergenic