ID: 1138230242

View in Genome Browser
Species Human (GRCh38)
Location 16:55331216-55331238
Sequence GCCCGTCAGTTCCCATTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138230242_1138230249 7 Left 1138230242 16:55331216-55331238 CCAACCAATGGGAACTGACGGGC No data
Right 1138230249 16:55331246-55331268 GGGTCTTTGTCCCCCTTGCTAGG No data
1138230242_1138230254 23 Left 1138230242 16:55331216-55331238 CCAACCAATGGGAACTGACGGGC No data
Right 1138230254 16:55331262-55331284 TGCTAGGAGTGTCGAGCGACCGG No data
1138230242_1138230257 29 Left 1138230242 16:55331216-55331238 CCAACCAATGGGAACTGACGGGC No data
Right 1138230257 16:55331268-55331290 GAGTGTCGAGCGACCGGGTTGGG No data
1138230242_1138230256 28 Left 1138230242 16:55331216-55331238 CCAACCAATGGGAACTGACGGGC No data
Right 1138230256 16:55331267-55331289 GGAGTGTCGAGCGACCGGGTTGG No data
1138230242_1138230255 24 Left 1138230242 16:55331216-55331238 CCAACCAATGGGAACTGACGGGC No data
Right 1138230255 16:55331263-55331285 GCTAGGAGTGTCGAGCGACCGGG No data
1138230242_1138230258 30 Left 1138230242 16:55331216-55331238 CCAACCAATGGGAACTGACGGGC No data
Right 1138230258 16:55331269-55331291 AGTGTCGAGCGACCGGGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138230242 Original CRISPR GCCCGTCAGTTCCCATTGGT TGG (reversed) Intergenic