ID: 1138230244

View in Genome Browser
Species Human (GRCh38)
Location 16:55331220-55331242
Sequence CCCTGCCCGTCAGTTCCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138230244_1138230256 24 Left 1138230244 16:55331220-55331242 CCAATGGGAACTGACGGGCAGGG No data
Right 1138230256 16:55331267-55331289 GGAGTGTCGAGCGACCGGGTTGG No data
1138230244_1138230257 25 Left 1138230244 16:55331220-55331242 CCAATGGGAACTGACGGGCAGGG No data
Right 1138230257 16:55331268-55331290 GAGTGTCGAGCGACCGGGTTGGG No data
1138230244_1138230255 20 Left 1138230244 16:55331220-55331242 CCAATGGGAACTGACGGGCAGGG No data
Right 1138230255 16:55331263-55331285 GCTAGGAGTGTCGAGCGACCGGG No data
1138230244_1138230254 19 Left 1138230244 16:55331220-55331242 CCAATGGGAACTGACGGGCAGGG No data
Right 1138230254 16:55331262-55331284 TGCTAGGAGTGTCGAGCGACCGG No data
1138230244_1138230249 3 Left 1138230244 16:55331220-55331242 CCAATGGGAACTGACGGGCAGGG No data
Right 1138230249 16:55331246-55331268 GGGTCTTTGTCCCCCTTGCTAGG No data
1138230244_1138230258 26 Left 1138230244 16:55331220-55331242 CCAATGGGAACTGACGGGCAGGG No data
Right 1138230258 16:55331269-55331291 AGTGTCGAGCGACCGGGTTGGGG No data
1138230244_1138230259 27 Left 1138230244 16:55331220-55331242 CCAATGGGAACTGACGGGCAGGG No data
Right 1138230259 16:55331270-55331292 GTGTCGAGCGACCGGGTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138230244 Original CRISPR CCCTGCCCGTCAGTTCCCAT TGG (reversed) Intergenic