ID: 1138230245

View in Genome Browser
Species Human (GRCh38)
Location 16:55331220-55331242
Sequence CCAATGGGAACTGACGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138230239_1138230245 -9 Left 1138230239 16:55331206-55331228 CCGGTACAGGCCAACCAATGGGA No data
Right 1138230245 16:55331220-55331242 CCAATGGGAACTGACGGGCAGGG No data
1138230233_1138230245 22 Left 1138230233 16:55331175-55331197 CCCGTTTTATCAAAAGTGTCAGC No data
Right 1138230245 16:55331220-55331242 CCAATGGGAACTGACGGGCAGGG No data
1138230234_1138230245 21 Left 1138230234 16:55331176-55331198 CCGTTTTATCAAAAGTGTCAGCA No data
Right 1138230245 16:55331220-55331242 CCAATGGGAACTGACGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138230245 Original CRISPR CCAATGGGAACTGACGGGCA GGG Intergenic
No off target data available for this crispr