ID: 1138230249

View in Genome Browser
Species Human (GRCh38)
Location 16:55331246-55331268
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138230242_1138230249 7 Left 1138230242 16:55331216-55331238 CCAACCAATGGGAACTGACGGGC No data
Right 1138230249 16:55331246-55331268 GGGTCTTTGTCCCCCTTGCTAGG No data
1138230239_1138230249 17 Left 1138230239 16:55331206-55331228 CCGGTACAGGCCAACCAATGGGA No data
Right 1138230249 16:55331246-55331268 GGGTCTTTGTCCCCCTTGCTAGG No data
1138230244_1138230249 3 Left 1138230244 16:55331220-55331242 CCAATGGGAACTGACGGGCAGGG No data
Right 1138230249 16:55331246-55331268 GGGTCTTTGTCCCCCTTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138230249 Original CRISPR GGGTCTTTGTCCCCCTTGCT AGG Intergenic
No off target data available for this crispr