ID: 1138230628

View in Genome Browser
Species Human (GRCh38)
Location 16:55333146-55333168
Sequence CTTTAGCCATAGAAGGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138230628_1138230637 10 Left 1138230628 16:55333146-55333168 CCAAACTCCTTCTATGGCTAAAG No data
Right 1138230637 16:55333179-55333201 CTCAGCTGCACAGCAACCAGGGG No data
1138230628_1138230639 23 Left 1138230628 16:55333146-55333168 CCAAACTCCTTCTATGGCTAAAG No data
Right 1138230639 16:55333192-55333214 CAACCAGGGGCTAGGCCCTCTGG No data
1138230628_1138230638 15 Left 1138230628 16:55333146-55333168 CCAAACTCCTTCTATGGCTAAAG No data
Right 1138230638 16:55333184-55333206 CTGCACAGCAACCAGGGGCTAGG No data
1138230628_1138230634 8 Left 1138230628 16:55333146-55333168 CCAAACTCCTTCTATGGCTAAAG No data
Right 1138230634 16:55333177-55333199 CCCTCAGCTGCACAGCAACCAGG No data
1138230628_1138230641 26 Left 1138230628 16:55333146-55333168 CCAAACTCCTTCTATGGCTAAAG No data
Right 1138230641 16:55333195-55333217 CCAGGGGCTAGGCCCTCTGGAGG No data
1138230628_1138230636 9 Left 1138230628 16:55333146-55333168 CCAAACTCCTTCTATGGCTAAAG No data
Right 1138230636 16:55333178-55333200 CCTCAGCTGCACAGCAACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138230628 Original CRISPR CTTTAGCCATAGAAGGAGTT TGG (reversed) Intergenic
No off target data available for this crispr