ID: 1138233354

View in Genome Browser
Species Human (GRCh38)
Location 16:55357739-55357761
Sequence AAAGTGGGCAGTCGCTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138233354_1138233359 3 Left 1138233354 16:55357739-55357761 CCTCCTCAGCGACTGCCCACTTT No data
Right 1138233359 16:55357765-55357787 CCTTTTTGTCTCTCACCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138233354 Original CRISPR AAAGTGGGCAGTCGCTGAGG AGG (reversed) Intergenic
No off target data available for this crispr