ID: 1138237079

View in Genome Browser
Species Human (GRCh38)
Location 16:55393151-55393173
Sequence CAGGAATGACAATTTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 281}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138237077_1138237079 -10 Left 1138237077 16:55393138-55393160 CCTCAAATATCTACAGGAATGAC 0: 1
1: 0
2: 1
3: 17
4: 231
Right 1138237079 16:55393151-55393173 CAGGAATGACAATTTGAGGAAGG 0: 1
1: 0
2: 0
3: 24
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138237079 Original CRISPR CAGGAATGACAATTTGAGGA AGG Intronic
900940721 1:5796886-5796908 GAGGAATGACAGGTGGAGGAAGG + Intergenic
902037492 1:13468236-13468258 CAGGGTGGACAGTTTGAGGAAGG + Intergenic
902417950 1:16253140-16253162 CATCTATGACAATCTGAGGAGGG + Exonic
903959031 1:27044991-27045013 CATGAATGACAAGGGGAGGAGGG - Intergenic
904639347 1:31911807-31911829 CAGGATTGGCCATTTGATGATGG - Exonic
906156333 1:43616243-43616265 CTCGTATGAGAATTTGAGGAGGG + Intronic
907133866 1:52120944-52120966 CAGGAAAGTCTTTTTGAGGAAGG - Intergenic
907180608 1:52566384-52566406 CAGGAATGGCAATATGTGTAGGG + Intergenic
907526428 1:55056599-55056621 CATGACTGACAACTTGAGCAAGG + Intronic
907644270 1:56225957-56225979 GAGGAAGGAAAATATGAGGAAGG + Intergenic
907686882 1:56620499-56620521 TTGGAATGAGGATTTGAGGATGG + Intronic
908801483 1:67885145-67885167 TAGAAATGAAAATTTGAGCATGG + Intergenic
908988830 1:70059563-70059585 CAAAAATGACAATTTGGGGTTGG - Intronic
909720508 1:78763359-78763381 CAGACATGACACTTTGAGAATGG - Intergenic
911242436 1:95480690-95480712 AAGGAAACACAATTTGAAGATGG - Intergenic
911947932 1:104135999-104136021 AAGGAATGAAACTTTGAAGAGGG - Intergenic
912904886 1:113693913-113693935 CAGAATTGAGAATTTGGGGAAGG + Intergenic
913132970 1:115859489-115859511 CAGCAGTGACAAGTTCAGGAGGG + Intergenic
913379319 1:118191412-118191434 AAGGAATGAGAAGTTGAAGACGG - Intergenic
914359965 1:146926115-146926137 CAGGAATTACTATTGGAGGCTGG - Intergenic
914409432 1:147411632-147411654 CAGGGAGGACAATGTGAAGACGG + Intergenic
914493786 1:148173780-148173802 CAGGAATTACTATTGGAGGCTGG + Intergenic
917046489 1:170866309-170866331 CAGAAATGAAACTTGGAGGAAGG - Intergenic
918658814 1:187063795-187063817 TAGGAATAACAATATGAGGTAGG + Intergenic
919159384 1:193808360-193808382 CAGCAATGAGAATTTGAGCCAGG + Intergenic
919747081 1:201015569-201015591 CAGGCATGCCAATTGGAGGCTGG - Intronic
920061379 1:203229201-203229223 CAGGACAGACAATATGAGGTTGG + Intronic
920416371 1:205801418-205801440 CAGGGATTGCAATTTGAGGGGGG - Intronic
922348440 1:224716589-224716611 CAGGAATGGAAATTTGGGGAAGG + Intronic
922954054 1:229584153-229584175 ATTGAATGACAATTTAAGGAAGG + Intergenic
923652010 1:235882962-235882984 CAGGGAAGAGTATTTGAGGAGGG - Intronic
924571258 1:245239831-245239853 CAGGAAAGACAACTTTTGGAAGG - Intronic
924612593 1:245586518-245586540 GAGGAATGACAAATTGTGGAGGG - Intronic
1063126633 10:3141965-3141987 CAGGAAGGATAATGTGTGGACGG - Intronic
1064587032 10:16849608-16849630 AAGGAAGGAAAATTTGTGGAGGG - Intronic
1066052625 10:31649217-31649239 GAGGACTGAAAATTGGAGGAAGG - Intergenic
1069743488 10:70700264-70700286 CAGGAAGGACAGTGTGGGGAGGG - Intronic
1070988384 10:80708776-80708798 AAGGAATGAGGATTTGAGTAAGG - Intergenic
1072657162 10:97337723-97337745 GAGGAATGAAAATTAGGGGAGGG + Intergenic
1074040266 10:109781272-109781294 CAGGAATGTCAACTAGAGGAGGG + Intergenic
1075490345 10:122862175-122862197 AAGGAATGCCATTTTGAGAAGGG - Intronic
1078754436 11:14195685-14195707 CAGAAAGGCCAATTTGAGGATGG + Intronic
1080231165 11:30018290-30018312 CTGGAGTTACAGTTTGAGGAAGG + Intergenic
1080540620 11:33260759-33260781 CAGGAATAACAACTTCTGGAAGG - Intronic
1081365236 11:42226909-42226931 CAGGAAAGATACTTTGAGTAAGG - Intergenic
1081690555 11:45074975-45074997 CAGCATTGCCAATATGAGGAAGG - Intergenic
1082915040 11:58424335-58424357 GAGGAAAGACAAATTGAAGAAGG - Intergenic
1084093089 11:66892121-66892143 AGGGAATGACAAGTTGAAGAAGG + Intronic
1086846705 11:91758724-91758746 TAGGAATGACAAATGGAGTATGG - Intergenic
1086888603 11:92229824-92229846 AAGGGATGAAAATTTGAGAATGG + Intergenic
1087190302 11:95247373-95247395 CTGGAATCACAATTTGTGGAAGG - Intergenic
1088598537 11:111456910-111456932 CAAGAATGTCAAGATGAGGAGGG - Intronic
1088805249 11:113346495-113346517 AAGGTATGACCATGTGAGGAAGG - Intronic
1090442076 11:126732703-126732725 GAGAAAAGACACTTTGAGGAAGG + Intronic
1090463926 11:126916352-126916374 CAGAAGTGACACTTTGAGGATGG - Intronic
1090614111 11:128499326-128499348 CAGGAATGATAATTATAGGTGGG - Intronic
1090907602 11:131090801-131090823 CAGGTATGCCACTTTGAGGTTGG - Intergenic
1091095203 11:132814488-132814510 CAGAAATGAAAACATGAGGAAGG + Intronic
1092758033 12:11783260-11783282 AAGGAAGGAGAATTTCAGGAAGG + Intronic
1092950433 12:13498555-13498577 CAGGAAAGACACTCTGAGGGAGG - Intergenic
1093670395 12:21867564-21867586 CAGGAATGACATTTGGAAGAAGG + Intronic
1094286578 12:28800961-28800983 AAGGAATGGCAAGTGGAGGAAGG - Intergenic
1096612194 12:52809513-52809535 CAGGAATGCCAGTAGGAGGACGG + Intronic
1099775457 12:87122183-87122205 CAGGAAGGCCAGTTTGGGGAAGG + Intergenic
1101582097 12:106050584-106050606 TAGTAATGACAGTGTGAGGAAGG - Intergenic
1102559235 12:113750251-113750273 AAGAAATGACCACTTGAGGAAGG + Intergenic
1103059896 12:117850126-117850148 CATGAAGGATACTTTGAGGATGG + Intronic
1103707042 12:122881248-122881270 CAGGAAACACAATCTTAGGAAGG + Intronic
1104045624 12:125160522-125160544 CAGAAATGCCAAGCTGAGGAAGG + Intergenic
1104137770 12:125956885-125956907 AAGTAATGACAAGTGGAGGAAGG - Intergenic
1106966866 13:35081576-35081598 CAGGAATGACAATATGTGTGAGG + Intronic
1108978646 13:56482389-56482411 CAGGAATGACAATGAGTGGTAGG + Intergenic
1110019420 13:70451247-70451269 CAGGAAAGACAGTTTGTGCAGGG - Intergenic
1111353061 13:87058776-87058798 AAGGAAGGAATATTTGAGGAAGG - Intergenic
1111371143 13:87319358-87319380 CAGGAAAGATAATGTGAAGATGG + Intergenic
1111652552 13:91110220-91110242 TCAGAATGACAATTTGGGGATGG + Intergenic
1112168123 13:96941771-96941793 AAGGAAGGAGAATTTGAGGAAGG - Intergenic
1113518572 13:110921642-110921664 CAATAGTGACAATTTCAGGAGGG - Intergenic
1114130511 14:19786386-19786408 AAGGAATGAAAATATGAAGAGGG + Intronic
1114574864 14:23703025-23703047 CAGCAAGGACAGTTGGAGGAAGG + Intergenic
1114894351 14:26968349-26968371 CAGAAATGTCATTTTGAGGTAGG + Intergenic
1115012604 14:28567636-28567658 CAGAAATGTCATTTTGATGAAGG - Intergenic
1115307590 14:31948310-31948332 AAGGAATGACAATTTATAGAGGG + Intronic
1115756976 14:36538250-36538272 CAGGGATCAAAGTTTGAGGAGGG - Intergenic
1116319130 14:43437119-43437141 CAGTAAAGAAAAATTGAGGAAGG - Intergenic
1118503072 14:66381582-66381604 CAGGACTGCCAATCTGTGGATGG - Intergenic
1119644165 14:76336578-76336600 CAGGAAAGACAATAGAAGGAAGG - Intronic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1125277518 15:38008861-38008883 CAGGCATGTCACATTGAGGAAGG + Intergenic
1126104673 15:45139587-45139609 GAGCAATGACACTGTGAGGAGGG + Exonic
1127283837 15:57515704-57515726 AAGGAATGACAATCTCAGGGTGG - Intronic
1127558104 15:60108243-60108265 CAGGAAAGAGAATTAGAGAATGG + Intergenic
1130201547 15:81833338-81833360 CAGGAGTGACCATTTAATGAAGG + Intergenic
1130825247 15:87537631-87537653 CAGGAATAATAATTTGCAGAGGG - Intergenic
1131380058 15:91956039-91956061 CAGCAAGGACAAGATGAGGAGGG + Intronic
1134591335 16:15456151-15456173 ACGGAATGACAATTTGAGGGTGG - Intronic
1135147659 16:19976943-19976965 TAGGACTTACATTTTGAGGAAGG + Intergenic
1137323804 16:47412885-47412907 CAGGAATGGCAATGTGTGGTAGG - Intronic
1137390282 16:48075527-48075549 CTGGACTGACAACTGGAGGATGG - Intergenic
1137962091 16:52891937-52891959 CAGAAATGAAAATTTGAGGCTGG + Intergenic
1138237079 16:55393151-55393173 CAGGAATGACAATTTGAGGAAGG + Intronic
1139677415 16:68533828-68533850 AAGGAATGAAAATTAGAAGATGG - Intronic
1140794951 16:78428525-78428547 CAGGAAGGACAGTTTCAAGATGG - Intronic
1146252210 17:31357117-31357139 CTGGAATAAAAATTTGAGGGTGG - Intronic
1147715404 17:42504322-42504344 CAGGAATGAGAGTTACAGGAAGG - Intronic
1149755492 17:59182353-59182375 CAGGAAGGAGAACCTGAGGAGGG - Intronic
1153003250 18:475232-475254 CAGGACTGACACTGGGAGGAAGG - Intronic
1153050689 18:900803-900825 CAGGAAAAACAATTCGGGGAAGG + Intergenic
1155507676 18:26548658-26548680 CGGGAATGACAATTGGAGCGCGG - Intronic
1156337621 18:36185265-36185287 CACGAATGGCACTCTGAGGAGGG - Intergenic
1157179317 18:45481813-45481835 TAAGAATAACAATTTGAGGGTGG + Intronic
1158305787 18:56103814-56103836 AAGGAAGGAAAATATGAGGAAGG + Intergenic
1158814807 18:61083000-61083022 CAGGAATGACAATAGGAGGGAGG - Intergenic
1159422292 18:68237754-68237776 CTGGAAAGACAATTTCAGAAAGG + Intergenic
1160078422 18:75700705-75700727 GAAGAATGACAATATGTGGAGGG - Intergenic
1160548288 18:79676625-79676647 CAGGAATATCAGTTTGATGAGGG + Intergenic
1163068905 19:14821296-14821318 CAGGAATAACAATTAGATCAGGG + Intronic
1164867493 19:31616978-31617000 CAGGGATGAAAAGATGAGGATGG - Intergenic
925669587 2:6296908-6296930 CATGATTAACAATTTTAGGATGG + Intergenic
926434548 2:12824697-12824719 CAGGAGAGACACTTTGAGGAGGG - Intergenic
927412400 2:22842223-22842245 CACGAAATACAATTTAAGGAAGG + Intergenic
927805599 2:26143975-26143997 CACAAATTACAATTTGAGAAAGG + Intergenic
929967971 2:46549687-46549709 GAGGAATGACAAATTGCTGAGGG - Intronic
933585678 2:84177368-84177390 CATGAATGAGAATTTGGGGGAGG + Intergenic
934106751 2:88702129-88702151 CTGGGAGTACAATTTGAGGAGGG + Intronic
937180855 2:119995179-119995201 CAGGAATGATCACTTGAGGCAGG - Intergenic
939121778 2:138125898-138125920 CATGACTCACAATTAGAGGATGG + Intergenic
939509362 2:143087984-143088006 AAGGAACGATAATTTGGGGAAGG - Intergenic
941413468 2:165188965-165188987 CATGGATGACTATTTGAGAAAGG + Intronic
941507285 2:166362616-166362638 CTGGAATATAAATTTGAGGAAGG - Intronic
942700650 2:178705581-178705603 TAGGAATGAAAATTTTAAGAAGG + Intronic
946061080 2:216942067-216942089 CAGGAATGAAGATGGGAGGAAGG - Intergenic
947153827 2:227140679-227140701 TAGGAAGGACAGTTTGATGAGGG - Intronic
947237965 2:227963585-227963607 CAAGACTGAAAATTTGGGGACGG - Intergenic
947504500 2:230696778-230696800 AAGGATTGACAATTTGGGCAAGG + Intergenic
948638175 2:239353822-239353844 CAGTAATGACATTTTGTGGTGGG - Intronic
1168789810 20:568453-568475 CAGGAGTGACAATGGGGGGAAGG - Intergenic
1169042426 20:2507559-2507581 TAGCATTGTCAATTTGAGGAAGG - Intronic
1169599868 20:7245888-7245910 GAGAAATGAGTATTTGAGGATGG - Intergenic
1170296545 20:14832436-14832458 ATGGAATGGCAGTTTGAGGAAGG + Intronic
1171483401 20:25469561-25469583 CAGCAATGACCCTCTGAGGAAGG + Intronic
1173319854 20:41977626-41977648 CAGGAAGAATCATTTGAGGAAGG - Intergenic
1174380062 20:50150540-50150562 CAGGAATGACATTTTAGGGAGGG - Intronic
1175652193 20:60735204-60735226 CAGAACTGTCAATTGGAGGAAGG + Intergenic
1177211009 21:18070741-18070763 CAGGAAGGACATGTGGAGGACGG - Intronic
1178019110 21:28389094-28389116 CAAGAAAGGCAATTTGAAGATGG - Intergenic
1178813578 21:35906626-35906648 CAGCAATGACAATGAGAAGAAGG + Intronic
1182059491 22:27386833-27386855 CAAGAAATACAGTTTGAGGAGGG + Intergenic
1183707925 22:39486440-39486462 CAGGCATAAAAATTTGAGGTCGG - Intronic
950744933 3:15080308-15080330 CAGGCATGACCATTAGAGCAGGG - Intronic
950918714 3:16670859-16670881 AAGGCAGGACAATTTGAAGAGGG - Intergenic
951955104 3:28244630-28244652 GAGGAATGAGAATTTGAGCCTGG + Intronic
952198993 3:31105942-31105964 CAGGGATCACAGATTGAGGATGG + Intergenic
952214497 3:31263766-31263788 TAAAAATGAAAATTTGAGGAAGG - Intergenic
952579174 3:34810864-34810886 CAGGAATGACCATTAGATAATGG - Intergenic
953260585 3:41334965-41334987 CAGGGATGAGAATTTAAGGCAGG + Intronic
955200085 3:56843854-56843876 CATGAATGGCAATTTGAGGGAGG + Intronic
955886532 3:63605216-63605238 CAGGAAAGACTATCTGGGGAGGG + Intronic
958455437 3:94325375-94325397 CTGGAATGACCCTTTGAGGTAGG - Intergenic
959394895 3:105824701-105824723 CAGAAATGACAATTTGGAGAGGG + Intronic
961638695 3:128350948-128350970 CAGGATTGACAAATTCTGGAAGG - Intronic
965516238 3:169624468-169624490 ATGGAAAGACAAGTTGAGGATGG + Intronic
966982447 3:185150948-185150970 CAGGAAAGACATTGTGAGAATGG + Intronic
967258172 3:187614360-187614382 CAGAATTGACAATGAGAGGAAGG - Intergenic
971380447 4:26092392-26092414 ATGGAATGAGAATTTGAGGGAGG + Intergenic
972425571 4:38929475-38929497 CAGTAATTAAGATTTGAGGAGGG + Intronic
973115688 4:46455528-46455550 CAGAAGTCACAATCTGAGGAAGG + Intronic
974439393 4:61897766-61897788 CAGGTATTACAATGAGAGGAAGG - Intronic
975184852 4:71389473-71389495 AAGGAATGAGGATGTGAGGATGG - Intronic
978660512 4:111120717-111120739 CAGCAAGGTCAAGTTGAGGAAGG - Intergenic
980581239 4:134754756-134754778 CAGTAATGGCAATGTGATGATGG + Intergenic
981551613 4:145947228-145947250 CAGGAATCACCATCTGTGGAAGG - Intergenic
982856049 4:160384297-160384319 GAGAAATGACCATTTGAGGTGGG - Intergenic
984855038 4:184187744-184187766 CAAGAATGTAAATTTCAGGAGGG + Intronic
985616340 5:924273-924295 CATGAATGACAACTAGATGATGG - Intergenic
986143613 5:5055387-5055409 CAGGAATAAAAACTTTAGGATGG + Intergenic
988174810 5:27708461-27708483 CTGGAAAGACATTTTGGGGAGGG + Intergenic
990556704 5:56943518-56943540 CAGGAATGACCATCTGTTGAGGG + Intronic
991016612 5:61939970-61939992 CAGAAATCACAATGAGAGGAAGG - Intergenic
992417875 5:76569889-76569911 AAGGAATGACTATCTGATGAGGG + Intronic
993283986 5:85965785-85965807 CAGGGATGAACATTTGAGGATGG - Intergenic
997215466 5:132106213-132106235 CAGGAATGCAAATTTGATTATGG + Intergenic
997737233 5:136222572-136222594 CAGCAAGGACAATTTGAGGGGGG - Intronic
998016099 5:138733638-138733660 CAGGAAAGGCATTTTGAGGAAGG + Intronic
998199052 5:140104255-140104277 CAAGTATGACAATTTGAAAATGG - Intergenic
999893192 5:156000917-156000939 CAGGGACCACACTTTGAGGATGG + Intronic
1000268523 5:159660498-159660520 CACGAATCTCAATTTGAAGAAGG - Intergenic
1002061384 5:176627896-176627918 AAGGACTGACTATGTGAGGAGGG + Intronic
1003703656 6:8498773-8498795 CAGAAAAGACACTTTGAGGGAGG - Intergenic
1004105745 6:12666118-12666140 CAGGGAAGTTAATTTGAGGATGG + Intergenic
1004636364 6:17471916-17471938 CTGGATTGACAGTTTCAGGAAGG + Intronic
1004642663 6:17530550-17530572 CATGAAGGACAGTTCGAGGAGGG + Intronic
1004950716 6:20668107-20668129 CAGGATACACAATTGGAGGAAGG - Intronic
1005436548 6:25817945-25817967 CAGCAATGGAATTTTGAGGATGG + Intronic
1005601505 6:27430993-27431015 CAAGAATGAAAATTAAAGGATGG - Intergenic
1005601517 6:27431102-27431124 CAAGAATGAAAATTAAAGGATGG - Intergenic
1006968037 6:38009903-38009925 CTGAAATGAGAATTTGTGGACGG + Intronic
1007427066 6:41754057-41754079 CAGGAATGAGAAATGGAGAAAGG - Intronic
1007995851 6:46307036-46307058 CAGAAATTGCCATTTGAGGATGG - Intronic
1008075775 6:47144098-47144120 GAGAAAAGAAAATTTGAGGAGGG - Intergenic
1008136659 6:47785052-47785074 CAGTAAAGAAAATTTAAGGAAGG + Intronic
1009061366 6:58401016-58401038 CAGGAATGAGAATGTGAGAAAGG - Intergenic
1009249038 6:61275568-61275590 CAGGAATGAGAATGTGAGAAAGG - Intergenic
1011882331 6:92045226-92045248 CAGGAATGACATTCTAAGAAAGG - Intergenic
1012021976 6:93934201-93934223 CTGGAGGGACAATTTGAAGATGG + Intergenic
1012023813 6:93962516-93962538 CAGAAAGGACAAATTGAGAAGGG + Intergenic
1014097672 6:117478466-117478488 CAGAAATGAAAATTAGAGAAAGG + Intronic
1015870357 6:137769974-137769996 CACGAATTACAATTTGAAAAGGG - Intergenic
1016421560 6:143890353-143890375 AAGGAATTACACTTTGTGGAAGG - Intronic
1017095571 6:150801734-150801756 AAGAAATAAGAATTTGAGGACGG - Intronic
1018640935 6:165903510-165903532 CAGAAAAGACAATTGGAGGAAGG + Intronic
1018844739 6:167547618-167547640 AAGGAGTGACAAGGTGAGGAGGG - Intergenic
1018975593 6:168562857-168562879 CACGGATGACAGTTTCAGGAGGG + Intronic
1023824578 7:44000462-44000484 CAGGAAGGAGAACCTGAGGAGGG + Intergenic
1023915991 7:44589627-44589649 GAGGAATGACAATCTGAAGTAGG + Intergenic
1024513995 7:50228079-50228101 CAGAAAGGACAAAATGAGGAAGG - Intergenic
1025106849 7:56178110-56178132 CAGGAATAACATCATGAGGAAGG - Intergenic
1026088130 7:67279224-67279246 CAGGAAGGAGAACCTGAGGAGGG + Intergenic
1026726113 7:72871047-72871069 CAGGAAGGAGAACCTGAGGAGGG - Intergenic
1027117728 7:75494557-75494579 CAGGAAGGAGAACCTGAGGAGGG + Intergenic
1027274076 7:76540923-76540945 CAGGAAGGAGAACCTGAGGAGGG - Intergenic
1027327518 7:77059975-77059997 CAGGAAGGAGAACCTGAGGAGGG - Intergenic
1027573203 7:79898104-79898126 CCTGAATGACAATTTGGAGAAGG + Intergenic
1029719769 7:102355498-102355520 CAGGAAGGAGAACCTGAGGAGGG - Intergenic
1029752844 7:102553760-102553782 CAGGAAGGAGAACCTGAGGAGGG + Intronic
1029770795 7:102652852-102652874 CAGGAAGGAGAACCTGAGGAGGG + Intronic
1030230007 7:107197883-107197905 CAGGAAAAACAAATTGAGCAAGG - Intronic
1030505237 7:110413687-110413709 CAGTAATGAGAATTTTAGGCTGG - Intergenic
1030619656 7:111775124-111775146 CATGAATGATTATTTGAGGGAGG + Intronic
1032094335 7:128930042-128930064 CTGGCAGGACAATTGGAGGATGG + Intergenic
1032803288 7:135333614-135333636 CAGGATGGACAATGTGAGGCTGG + Intergenic
1033925007 7:146447664-146447686 CAGGTTTAACAATTTGATGAAGG + Intronic
1035484154 7:159209284-159209306 CAAGAATGTGAATTTGAAGAAGG - Intergenic
1037188740 8:16096782-16096804 CAAGAATTGCAAATTGAGGAAGG + Intergenic
1039323253 8:36456375-36456397 AAGGAAAGACAAGTTGGGGAAGG - Intergenic
1039785336 8:40829773-40829795 TAGGGTTGAAAATTTGAGGATGG + Intronic
1040023733 8:42763096-42763118 CAAGAATGTGAATGTGAGGATGG + Intronic
1040880966 8:52204021-52204043 CAGAAATGAGAGTTTAAGGAAGG - Intronic
1040928043 8:52706318-52706340 CATGAATGACCATTTAGGGAAGG - Intronic
1041307915 8:56482668-56482690 CAGACATGACAATTTTAGGGAGG - Intergenic
1042074971 8:64983309-64983331 CATGAATAACAGGTTGAGGAAGG - Intergenic
1042668597 8:71234706-71234728 AAGGAATGAAAAATTGAGAAGGG - Intronic
1044309138 8:90673106-90673128 GAGGAATGACAAGTAGAAGAGGG + Intronic
1044392735 8:91670847-91670869 CAGGAAAGATAAATTGAAGAGGG + Intergenic
1047084282 8:121499062-121499084 GAGGAATGACAAAATGGGGAGGG + Intergenic
1048378101 8:133840050-133840072 TAGGAATGACAAATTGCTGAAGG - Intergenic
1048384674 8:133901086-133901108 AGGGAATGAAAATTTGAGGATGG - Intergenic
1048408692 8:134149641-134149663 CATGAATAAAAATTTGAGGCAGG - Intergenic
1048418111 8:134249666-134249688 TAGGAATGACAAATTCAGCAGGG - Intergenic
1050125198 9:2349345-2349367 CATGAATGGCACTTAGAGGAGGG - Intergenic
1050311197 9:4354774-4354796 AAGGAATGACTCTTTGAGGGTGG - Intergenic
1050434031 9:5590510-5590532 CAGGAACAACAGTTTGTGGATGG + Intergenic
1050468613 9:5960590-5960612 CAATAATGACTATTTGAGGGGGG + Intronic
1050512194 9:6407786-6407808 TAGGAATGACAAATTGCAGAAGG + Intergenic
1051058354 9:13015253-13015275 TAGAAATGACAAGTTGGGGATGG + Intergenic
1055408747 9:76004148-76004170 CAGGAATGGGAAACTGAGGAGGG + Intronic
1055546582 9:77380742-77380764 CAGGAGGGATAATTTCAGGATGG + Intronic
1056015016 9:82376392-82376414 GAGGAATTGCACTTTGAGGAGGG + Intergenic
1056323365 9:85457507-85457529 CAGGAATGACCATTGGAGAAGGG + Intergenic
1056587007 9:87934306-87934328 CTGGAATTACAATATGAAGATGG + Intergenic
1056609867 9:88118630-88118652 CTGGAATTACAATATGAAGATGG - Intergenic
1057934611 9:99226485-99226507 CTGGAATGAGATTTTGAGGGAGG + Intronic
1058290524 9:103235372-103235394 GAGGTAAGACAATTTTAGGAGGG + Intergenic
1059281012 9:113134118-113134140 CAGGAATGGCAGTTTCAGGTTGG + Intergenic
1061110657 9:128567588-128567610 CTGGAATGAGTTTTTGAGGAAGG + Intronic
1062391282 9:136334921-136334943 CAGCAGTTACAGTTTGAGGAGGG + Intronic
1185676649 X:1854891-1854913 GAGGAAAGACAACTTGAAGATGG + Intergenic
1185825034 X:3241763-3241785 CAGGAATGAGAGAGTGAGGAGGG + Intergenic
1185870109 X:3657791-3657813 CAGCAATGAGAGATTGAGGAAGG + Intronic
1187737859 X:22322772-22322794 TAGAAATGAAAATTTGGGGAAGG + Intergenic
1189555865 X:42144689-42144711 CAGAGATGACATTTTGAGCATGG - Intergenic
1191277318 X:58615871-58615893 CAGAAACGACATTGTGAGGATGG + Intergenic
1191283427 X:58697833-58697855 CAGAAACGACATTGTGAGGATGG + Intergenic
1191293298 X:58829472-58829494 CAGAAACGACATTGTGAGGATGG + Intergenic
1191318166 X:59161294-59161316 CAGAAACGACATTGTGAGGATGG + Intergenic
1191321249 X:59202431-59202453 CAGAAACGACATTGTGAGGATGG + Intergenic
1191342157 X:59482123-59482145 CAGAAACGACATTGTGAGGATGG + Intergenic
1191366334 X:59805196-59805218 CAGAAACGACATTGTGAGGATGG + Intergenic
1191368070 X:59828509-59828531 CAGAAACGACATTGTGAGGATGG + Intergenic
1191374514 X:59914559-59914581 CAGAAACGACATTTTGAGGATGG + Intergenic
1191375430 X:59926899-59926921 CAGAAACGACATTGTGAGGATGG + Intergenic
1191379076 X:59975772-59975794 CAGAAACGACATTGTGAGGATGG + Intergenic
1191379539 X:59981942-59981964 CAGAAACGACATTGTGAGGATGG + Intergenic
1191400070 X:60256706-60256728 CAGAAACGACATTGTGAGGATGG + Intergenic
1191403268 X:60299394-60299416 CAGAAAAGACTTTTTGAGGATGG + Intergenic
1191432428 X:60690596-60690618 CAGAAACGACATTGTGAGGATGG + Intergenic
1191434996 X:60724707-60724729 CAGAAACGACATTGTGAGGATGG + Intergenic
1191436686 X:60747334-60747356 CAGAAACGACATTGTGAGGATGG + Intergenic
1191440306 X:60795843-60795865 CAGAAACGACATTGTGAGGATGG + Intergenic
1191457883 X:61030901-61030923 CAGAAACGACATTGTGAGGATGG + Intergenic
1191482017 X:61354034-61354056 CAGAAACGACATTGTGAGGATGG + Intergenic
1191487484 X:61427418-61427440 CAGAAACGACATTGTGAGGATGG + Intergenic
1191496631 X:61549472-61549494 CAGAAACGACATTGTGAGGATGG + Intergenic
1191522504 X:61895397-61895419 CAGAAACGACATTGTGAGGATGG + Intergenic
1191557861 X:62368482-62368504 CAGAAACGACATTGTGAGGATGG + Intergenic
1191700508 X:64037116-64037138 CAGTAATGTAAATTTGGGGAAGG + Intergenic
1193140363 X:78020353-78020375 CAAGTTTGACAATTTGAGAAAGG - Exonic
1193216504 X:78870597-78870619 CAGGAAAAACATTTTGTGGAGGG + Intergenic
1193396951 X:80996164-80996186 TAGGAATACCAATTTGAGAAAGG + Intergenic
1195387822 X:104329714-104329736 CAGGCGTGACTATTTGAGTATGG - Intergenic
1195720535 X:107863471-107863493 CAGAAATGAGAACTAGAGGAGGG - Intronic
1196190922 X:112793542-112793564 CAGCAATTCTAATTTGAGGAGGG - Intronic
1197312638 X:124924735-124924757 AAGAAATGACTATTTGAGGCTGG + Intronic
1197852395 X:130876935-130876957 CTGGATTGACCACTTGAGGATGG + Intronic
1201254278 Y:12091682-12091704 CAGGAATGAGAGAATGAGGAGGG - Intergenic
1201672316 Y:16537636-16537658 CATAAATGACGATTTGTGGAAGG - Intergenic