ID: 1138237797

View in Genome Browser
Species Human (GRCh38)
Location 16:55399887-55399909
Sequence GCTTTTTCTACTCACCATGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138237793_1138237797 14 Left 1138237793 16:55399850-55399872 CCTCAGGCCAGGCATCACATGCT 0: 1
1: 0
2: 1
3: 12
4: 224
Right 1138237797 16:55399887-55399909 GCTTTTTCTACTCACCATGGCGG 0: 1
1: 0
2: 0
3: 17
4: 154
1138237794_1138237797 7 Left 1138237794 16:55399857-55399879 CCAGGCATCACATGCTTATGCAA 0: 1
1: 0
2: 0
3: 12
4: 125
Right 1138237797 16:55399887-55399909 GCTTTTTCTACTCACCATGGCGG 0: 1
1: 0
2: 0
3: 17
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138237797 Original CRISPR GCTTTTTCTACTCACCATGG CGG Intronic
901651688 1:10746752-10746774 GCTTTTTCTACCACCCCTGGAGG + Intronic
906359849 1:45145535-45145557 GCTTTTTTTACTCAGCATAATGG - Intronic
908711303 1:67018681-67018703 CCTTTTTCTCTTCAGCATGGTGG - Intronic
909810578 1:79928089-79928111 GCTTTATATACTGACCATGGTGG - Intergenic
910448654 1:87325340-87325362 GCTTTTTGTATTCACGTTGGAGG + Intergenic
911372913 1:97015457-97015479 GCTGTGTTTACTCACCATGGTGG + Intergenic
911875066 1:103150882-103150904 GCTTTTTCTTCTCAACTTAGTGG + Intergenic
915646942 1:157279187-157279209 TCTCTTTTTACTCACCCTGGCGG + Intergenic
916640279 1:166720745-166720767 GCTTTCTCTTTTCACAATGGTGG + Intergenic
919603861 1:199655645-199655667 GCTTTTTTTTTTAACCATGGGGG - Intergenic
921327544 1:214001581-214001603 GCTTTTTCTACTCAACTTTTAGG + Intronic
923125395 1:231029966-231029988 GCTTTTTCTAAACACTATGCAGG - Intronic
923911346 1:238447648-238447670 GCTTTTTCTATTCACCACTCAGG - Intergenic
1066602366 10:37123451-37123473 GCTGTTTCTACTAAACATGTTGG + Intergenic
1067698380 10:48551643-48551665 GCTTTATATACTGACCATGTCGG + Intronic
1067823111 10:49548385-49548407 GCTTTGTCTTTTCACAATGGGGG - Intergenic
1074288848 10:112123124-112123146 GCTTTTTCTTCTCAAAATGAAGG - Intergenic
1074767782 10:116713302-116713324 GCTGTTTTTAATCACTATGGTGG + Intronic
1075164702 10:120056779-120056801 GCTTTTTCGGCTCAGCATGGTGG - Intergenic
1075984898 10:126776511-126776533 GCATGTTCTACCCATCATGGGGG - Intergenic
1077873790 11:6285318-6285340 GCTTTCTCTTTTCACAATGGTGG + Intergenic
1078706305 11:13747268-13747290 GCTTTGCCCACTCCCCATGGTGG + Intergenic
1080173326 11:29332605-29332627 GCCTTTTCTGGTCCCCATGGGGG - Intergenic
1081458063 11:43244921-43244943 GCTCTTTCTACTCACCCCGCAGG - Intergenic
1082891578 11:58144575-58144597 CATTTTTCTCATCACCATGGGGG + Intronic
1085480285 11:76816534-76816556 GCTTTCTCTTTTCACAATGGCGG - Intergenic
1085788360 11:79474656-79474678 GCTTTTCATACTCAACAGGGAGG + Intergenic
1086577814 11:88360874-88360896 GGTTTTTCTACTCTCCCTAGCGG + Intergenic
1088354772 11:108931240-108931262 GCTTCTCCAACTCCCCATGGTGG - Intronic
1092470992 12:8780922-8780944 GATTTTTCTCCTCAGCATGTTGG + Intronic
1092973153 12:13718299-13718321 GCTTTGTCTCCTCACCTTGAAGG - Intronic
1093683948 12:22035150-22035172 GCTTTTTCTTCCTACCATTGTGG - Intergenic
1093735476 12:22615288-22615310 GCTTTCTCTTTTCACAATGGTGG + Intergenic
1095198101 12:39347713-39347735 GCTTTTTCTAATCACTATACTGG - Intronic
1095602556 12:44029931-44029953 GCTTTCTCTTTTCACAATGGCGG + Intronic
1098502326 12:71207260-71207282 GCTTTCTCTTTTCACAATGGTGG + Intronic
1102270347 12:111529293-111529315 GCTTTTGTTTCTCACCATAGGGG - Intronic
1103729987 12:123021110-123021132 CCTTTTCCTGCCCACCATGGTGG + Intronic
1106305949 13:28509691-28509713 GATTTTTCTACTCACCAGCATGG - Intergenic
1107311491 13:39083095-39083117 GCTTTGTCTTTTCACAATGGTGG + Intergenic
1109449360 13:62489472-62489494 ATTTTTTCTACTTACTATGGTGG - Intergenic
1112320599 13:98403667-98403689 GTTTCTTCTTCTCTCCATGGCGG + Intronic
1112337150 13:98525103-98525125 GATTTTTCTTCTGGCCATGGGGG - Intronic
1113648946 13:112020235-112020257 GCTTCTTCAACTCAGCATGTTGG + Intergenic
1114330773 14:21634680-21634702 GCTCATTCTGCTCACCATGTGGG - Exonic
1115304058 14:31915719-31915741 GCTTTTTCTGCTCATCCTGTAGG + Intergenic
1117540218 14:56739601-56739623 GCTTTGTGTACTCACCTTGGAGG - Intergenic
1117595183 14:57320025-57320047 GCTCATTCTACCCAGCATGGGGG + Intergenic
1117769864 14:59122782-59122804 GCTTTTTCTACTAACCTGTGTGG + Intergenic
1122506372 14:102234377-102234399 TCTCTTTTTACTCACCCTGGCGG - Intronic
1122592056 14:102860721-102860743 GCTTTGTCTTTTCACAATGGTGG - Intronic
1125992772 15:44126204-44126226 TCTTTTTTTACTCACCAAGCTGG - Intronic
1126084530 15:44999423-44999445 GCTGTTTCTACTCATCGTGAAGG - Intergenic
1128436630 15:67657144-67657166 GCTTCTTCTACTGATAATGGTGG + Intronic
1131575450 15:93585751-93585773 GCTTTTTCTTCTCTGGATGGTGG - Intergenic
1132183316 15:99779335-99779357 GCATTTCCTACTCACCACAGTGG + Intergenic
1132435118 15:101794146-101794168 GCATTTCCTACTCACCACAGTGG - Intergenic
1134742645 16:16561530-16561552 GCCCTTTCTGATCACCATGGTGG + Intergenic
1135433494 16:22407955-22407977 GATTTTTCTCCTGAACATGGAGG + Intronic
1135597830 16:23756717-23756739 GCTTTTTGTTGTCACAATGGGGG + Intronic
1136482035 16:30548102-30548124 TCTCTTTTTACTCACCCTGGTGG + Intronic
1138237797 16:55399887-55399909 GCTTTTTCTACTCACCATGGCGG + Intronic
1138389655 16:56661168-56661190 ACTTTTTATACTCAACATGGTGG - Intronic
1139836403 16:69842128-69842150 GCTCTTTGTCCTCACCAAGGGGG - Intronic
1140593960 16:76386668-76386690 GGCCATTCTACTCACCATGGTGG - Intronic
1140594125 16:76389173-76389195 GCTTGTTCTGCTCATCATGCTGG - Intronic
1149432803 17:56607925-56607947 GCTCTTTCTACTCATCATGTTGG - Intergenic
1149510806 17:57239887-57239909 TCTTTGTCTACTCACTATGTGGG - Intergenic
1150418370 17:65006160-65006182 GCTTTTTCTTTTCCCCATGAAGG - Intergenic
1152118942 17:78406386-78406408 GCGTTTTTTAAACACCATGGTGG - Intronic
1152236289 17:79140717-79140739 GCCTTTTCTAGACAGCATGGTGG - Intronic
1153328276 18:3844616-3844638 ACTTTTTTGATTCACCATGGCGG - Intronic
1154098256 18:11441344-11441366 GCTGTTTTTTCTCACCATGCTGG + Intergenic
1155003562 18:21708175-21708197 ACATTTTCTACACACCATGATGG - Intronic
1155850773 18:30770789-30770811 GCTTTTTCTTTTCACAATGGTGG + Intergenic
1155980843 18:32177827-32177849 GCTTCTTCTCACCACCATGGTGG + Intronic
1166632062 19:44415575-44415597 GCTATTTAAACTCACCCTGGCGG + Intergenic
927147234 2:20174213-20174235 GCTCTCTCTGCACACCATGGTGG + Intergenic
930009688 2:46926618-46926640 GCTTTTTCTAGGCACCTGGGGGG - Intronic
930351370 2:50259870-50259892 GCTTCCTCTACTCATCAAGGTGG + Intronic
935722571 2:105992442-105992464 GCTGGTGGTACTCACCATGGTGG + Intergenic
936248491 2:110848978-110849000 GCTTTTGCTATTTCCCATGGAGG + Intronic
937802637 2:126098071-126098093 GCTTTTTATTCTCGCCATGCTGG - Intergenic
941639553 2:167972475-167972497 GCTTTCTCTTTTCACAATGGCGG + Intronic
945059483 2:205896295-205896317 GCTTTTTCTTCTTGCCCTGGTGG + Intergenic
946622673 2:221575628-221575650 GCTTTTTCTAGGCATCCTGGTGG + Intergenic
947373725 2:229474499-229474521 GCTTTATCTAGGCAGCATGGAGG + Intronic
1172108279 20:32529557-32529579 GCTTTCTCGACACACCATGATGG + Intronic
1179265061 21:39795938-39795960 GATCTTTCTACTCATCATGGGGG + Intronic
1179882348 21:44298402-44298424 TCTTATTTTACTCAGCATGGTGG + Intronic
1181150724 22:20881357-20881379 CCTTGTTCTCCTCTCCATGGAGG - Intronic
1181902010 22:26164036-26164058 GATTTTTCTTCTCACCTTTGAGG + Intergenic
1183034934 22:35134352-35134374 AGTTTTTCTACTCAGCCTGGTGG + Intergenic
952162610 3:30709150-30709172 GCTTTTTCTAGCCACACTGGCGG + Intergenic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
957529815 3:81426792-81426814 ACTATTTCTACTGGCCATGGGGG + Intergenic
957547598 3:81660375-81660397 GCTTTATCTACACAAGATGGGGG - Intronic
960039014 3:113130400-113130422 GCTTTTTCTACTTTCCGTTGAGG - Intergenic
960514780 3:118591216-118591238 GCTTTCTCTTTTCACGATGGTGG + Intergenic
960824180 3:121766270-121766292 ACTTTTTTTACTCAAGATGGTGG + Intergenic
960824454 3:121768152-121768174 ACTTTTTTTACTCAAGATGGTGG - Intergenic
961505507 3:127368490-127368512 GCTTTCTCTTCTCACCCTGCAGG - Intergenic
961510764 3:127401983-127402005 GCTTTCTCTTTTCACAATGGAGG - Intergenic
962105480 3:132384264-132384286 GCATGTTCTACTCACCCTAGGGG - Intergenic
963782341 3:149498928-149498950 GCTGTTTCTTCTCAGCATGAGGG + Intronic
964229198 3:154443254-154443276 GCTTTGTCTACTCACAAAGTTGG + Intergenic
964345076 3:155746792-155746814 GGCTTTTCTATTCACCATGGAGG - Intergenic
964666681 3:159182264-159182286 GCACTCTTTACTCACCATGGTGG + Intronic
967406955 3:189127203-189127225 GTTCCTTCTACTCACCTTGGAGG - Intronic
969634660 4:8360128-8360150 GCTTTCTCTTTTCACAATGGTGG + Intergenic
971089876 4:23329361-23329383 GCTTTCACTGCTCACCTTGGAGG + Intergenic
972039784 4:34578668-34578690 GCTTTTTATTCTGACCATGCTGG - Intergenic
974922612 4:68260808-68260830 GCTTTGTCTTTTCACAATGGTGG + Intergenic
977233194 4:94476597-94476619 GCTTTCTATACTCATGATGGAGG - Intronic
977628028 4:99209880-99209902 TCTTTTACTACTCACCAAGAGGG + Intronic
980778513 4:137466154-137466176 GCTTTCTCTTTTCACAATGGTGG + Intergenic
984996678 4:185438556-185438578 GATTTTTCTTCTCAGTATGGGGG + Intronic
986450756 5:7862050-7862072 GCTTTCTTTACTTACCATGGAGG - Intronic
986927880 5:12781018-12781040 GGTTTTTCTACTTACTATGAGGG - Intergenic
986987554 5:13516320-13516342 GCATTTGTTACTCACCATGCTGG + Intergenic
992439122 5:76782629-76782651 GCTTTCTCTTTTCACAATGGTGG + Intergenic
995615545 5:113959277-113959299 GCTTTTTCTTTTCTCCATGTGGG - Intergenic
995944760 5:117631020-117631042 CCTATTTCTACTCAGCATTGGGG - Intergenic
998958729 5:147463233-147463255 GCTTGCTCTACTCACCAAGATGG - Intronic
999459445 5:151745317-151745339 GCCTCTGCTACTCACCAGGGTGG + Intronic
1000181823 5:158819033-158819055 CATTTCTCTAGTCACCATGGAGG + Intronic
1001049716 5:168404451-168404473 GCTTTGTTTTCTCTCCATGGAGG + Intronic
1002904391 6:1437159-1437181 GCTTTTTCTGATCACCAGGACGG - Intergenic
1009716737 6:67406990-67407012 GCTTTGTCTTTTCACAATGGTGG + Intergenic
1011207347 6:84913882-84913904 GCTTTGTCAAGGCACCATGGAGG + Intergenic
1013660468 6:112290744-112290766 CCTCTCACTACTCACCATGGAGG + Intergenic
1014111629 6:117624115-117624137 GCTTTCTCTTTTCACAATGGTGG + Intergenic
1017937139 6:159015782-159015804 GCTCTTTCTACTTCCCATGGTGG - Intergenic
1018357465 6:163033726-163033748 GCTTTCTCTTTTCACAATGGTGG - Intronic
1019576816 7:1741550-1741572 GATTCTTATACTCACAATGGGGG + Intronic
1023587838 7:41749755-41749777 GCTTTGTCTTTTCACAATGGTGG - Intergenic
1027157169 7:75776673-75776695 GCTTTTTATATTCACCATGTGGG - Intronic
1028389062 7:90294543-90294565 GCTTTCTCTTTTCACAATGGCGG - Intronic
1029133070 7:98348796-98348818 GGGTTATTTACTCACCATGGAGG - Intronic
1029558913 7:101289674-101289696 GCTTTCCCTACTCACCATCTTGG + Intergenic
1029811097 7:103049958-103049980 GCTTTCTCTTTTCACAATGGTGG - Intronic
1032459330 7:132098113-132098135 GCTTTATCTGTTCACCATGGAGG - Intergenic
1032483098 7:132262453-132262475 GCTTTTTCCCCTTTCCATGGAGG + Intronic
1032671747 7:134090247-134090269 GCTTTCTCTTTTCACAATGGTGG - Intergenic
1033161746 7:139002904-139002926 GCTTTCTCTTTTCACAATGGTGG + Intergenic
1033186649 7:139232117-139232139 GCTTTCTCCACTCCCCAGGGTGG + Intronic
1034808080 7:154106077-154106099 CCTTTCTCTCCTCTCCATGGGGG - Intronic
1035274044 7:157736805-157736827 GATTTTTTCACTCAACATGGAGG - Intronic
1037586756 8:20282111-20282133 GCCTTTTCTAGTCACCACGAGGG + Intronic
1040500173 8:47998535-47998557 TCTCTTTTTACTCACCCTGGCGG + Intergenic
1043223855 8:77699545-77699567 GCTTTTTCCACTTACCAGGGAGG - Intergenic
1044103939 8:88177587-88177609 GCTTTTTTTCCTCCCCATGCTGG - Intronic
1045428248 8:102088200-102088222 GCTTTCTCTTTTCACAATGGTGG + Intronic
1045462390 8:102436988-102437010 TGCTTTTCTACTCACAATGGAGG - Intergenic
1046658213 8:116920021-116920043 GCTTTTTCTTTTCACCCTAGAGG - Intergenic
1047354225 8:124105090-124105112 GGGATTTCTACTCACTATGGTGG + Intronic
1047397097 8:124511029-124511051 GTTATTTCTAGTTACCATGGCGG - Intronic
1050745479 9:8870965-8870987 GCTTTTTCTTCTCAGCAGGCAGG - Intronic
1054896112 9:70313433-70313455 GCTTTTTCTCTTGACTATGGTGG + Intronic
1058015870 9:100031442-100031464 GCTTTGTCTTTTCACAATGGTGG + Intronic
1058631376 9:106990802-106990824 GCATTTTGTACTCATCATGTAGG - Intronic
1058879027 9:109270717-109270739 ACTTGTTCTACTCAACATGGTGG - Intronic
1059351508 9:113668678-113668700 GCTTTTTCTAGTTTTCATGGAGG - Intergenic
1060260276 9:122068687-122068709 GCTTTTTCTACACTGCATTGTGG + Intronic
1187351906 X:18526713-18526735 GATTTTTCTACTTAGCATGGTGG + Intronic
1192730631 X:73799698-73799720 GCTTTTTCTTTTCACAATGGTGG - Intergenic
1192888559 X:75363456-75363478 GCTTTGTCTTTTCACAATGGTGG + Intergenic
1193315273 X:80057612-80057634 GCTTTGTCTTTTCACAATGGTGG - Intergenic
1196347338 X:114679200-114679222 GCTTTTTCTACACACAGTGCTGG + Intronic
1196551659 X:117033942-117033964 GTTTCTACTACTCACCATTGTGG + Intergenic
1198880049 X:141271067-141271089 TCTTTATCCACTCATCATGGAGG + Intergenic
1199742680 X:150750471-150750493 GCTTCCACTTCTCACCATGGCGG - Intronic