ID: 1138238023

View in Genome Browser
Species Human (GRCh38)
Location 16:55402030-55402052
Sequence AGCATCATTTTTACTCACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 478
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 457}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138238023_1138238027 -5 Left 1138238023 16:55402030-55402052 CCACAGTGAGTAAAAATGATGCT 0: 1
1: 0
2: 0
3: 20
4: 457
Right 1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG 0: 1
1: 0
2: 1
3: 11
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138238023 Original CRISPR AGCATCATTTTTACTCACTG TGG (reversed) Intronic
901442226 1:9285383-9285405 TGGATAATTTCTACTCACTGAGG - Intergenic
902256078 1:15189519-15189541 AGCATCATCTCTACCCTCTGGGG - Intronic
904445260 1:30568260-30568282 AGCATGATTTATACTCATTTGGG - Intergenic
905939946 1:41855008-41855030 AGCATGATTTATACTCATTTGGG + Intronic
906217058 1:44048387-44048409 AGCGTCCTTTTAGCTCACTGTGG - Intergenic
906591046 1:47024143-47024165 AGCATCATTTTTCCTTGCTCTGG + Intronic
907034865 1:51207255-51207277 ACAATCATTTGTTCTCACTGGGG - Intergenic
907783294 1:57587157-57587179 AGCAAGATTTTTACTCATTTAGG - Intronic
907836663 1:58115495-58115517 AGCATGATTTATACTCATTTGGG - Intronic
908180862 1:61604094-61604116 AGCATCTTTTTTACTTCCAGAGG + Intergenic
908313067 1:62905101-62905123 AGAATCATCTTTAATAACTGAGG + Intergenic
908716805 1:67079376-67079398 AGCATGATTTATACTCATTTGGG + Intergenic
909126848 1:71683452-71683474 GGCATCATTTTAATTTACTGAGG - Intronic
909333832 1:74447767-74447789 AGCATGATTTATACTCATTTGGG - Intronic
909339832 1:74519366-74519388 AGCATGATTTATACTCATTTGGG + Intronic
910026516 1:82661285-82661307 AGCATGATTTATACTCATTTGGG - Intergenic
910143490 1:84052861-84052883 AGCATGATTTATACTCATTTGGG + Intergenic
910320012 1:85932594-85932616 AGCATGATTTATACTCATTTGGG - Intronic
910349054 1:86275501-86275523 AGCATGATTTATACTCATTTGGG - Intergenic
910489554 1:87753851-87753873 ATCCTCATTTTAACTCTCTGAGG + Intergenic
911181524 1:94864824-94864846 AGGGTCATTTTTAATCTCTGTGG + Exonic
912001742 1:104844318-104844340 AGCATGATTTATACTCATTTGGG + Intergenic
913136985 1:115900664-115900686 AGCAGCATTTTTCCCCATTGTGG - Intergenic
913732894 1:121736061-121736083 AGCATGATTTATACTCATTTGGG - Intergenic
913941389 1:125111047-125111069 AGCATGATTTATACTCATTTGGG + Intergenic
914867064 1:151439610-151439632 AGCATCATTTGTAATCACAAAGG + Intronic
915756667 1:158267630-158267652 AGCATGATTTATACTCATTTGGG + Intergenic
918751089 1:188270274-188270296 AGCATCATTCTTAGTGACTAAGG - Intergenic
919070333 1:192747533-192747555 GGCCTCATTTATATTCACTGGGG - Intergenic
919433803 1:197531927-197531949 AGCATGATTTATACTCATTTGGG + Intronic
919588597 1:199470565-199470587 AGCATGATTTATACTCATTTGGG - Intergenic
919692766 1:200542319-200542341 GGCATGATTATGACTCACTGTGG - Intergenic
921684340 1:218072642-218072664 AGCATGATTTATACTCATTTGGG - Intergenic
922591753 1:226782684-226782706 ATCCTCATCTTTCCTCACTGAGG + Intergenic
1063339604 10:5250879-5250901 AGCATGATTTATACTCATTTGGG - Intergenic
1063480332 10:6370120-6370142 AGCATGATTTATACTCATTTGGG + Intergenic
1063508738 10:6625975-6625997 ACCATCCTTTGTACTCAGTGTGG - Intergenic
1063896542 10:10688374-10688396 AGCATCTTTCTTTCTGACTGTGG - Intergenic
1064617854 10:17181065-17181087 AACATCAAATTTATTCACTGTGG + Intronic
1064808128 10:19161010-19161032 AGCATGATTTATACTCATTTGGG - Intronic
1065364453 10:24921849-24921871 AGCATTATTGTTAATCACTCAGG - Intronic
1068437006 10:57005451-57005473 AGCATGATTTATAGTCACTTGGG - Intergenic
1068828289 10:61464437-61464459 AGCACAATCTTGACTCACTGCGG + Intergenic
1069268394 10:66492642-66492664 AGCACCATTGTTATTCCCTGTGG + Intronic
1069328917 10:67266614-67266636 ATCATGATAGTTACTCACTGTGG - Intronic
1071375558 10:84998790-84998812 GGCTTCATTTTGACTCCCTGAGG - Intergenic
1071526350 10:86361947-86361969 AGCATCATGTTTAGTCCCTGGGG + Intronic
1073626124 10:105099142-105099164 AGCATCCTTTTTCTTGACTGGGG - Intronic
1073652617 10:105377831-105377853 AGCATGATTTATACTCATTTGGG + Intergenic
1078258695 11:9683721-9683743 AGGATCACTTTTCCTCAATGTGG - Intronic
1079761378 11:24333475-24333497 AGCATGATTTATACTCATTTGGG - Intergenic
1080906585 11:36552090-36552112 AGCATGATTTATACTCATTTGGG + Intronic
1081299451 11:41432797-41432819 GGCATCATTTTTCCCCCCTGTGG + Intronic
1081679034 11:44989019-44989041 AGCATAATCATAACTCACTGTGG - Intergenic
1082241989 11:49883282-49883304 AATATCATTTTTTCTCCCTGTGG - Intergenic
1083076820 11:60049187-60049209 AGCATGATTTATACTCATTTGGG + Intergenic
1083195760 11:61085864-61085886 AGCATGATTTATACTCATTTGGG - Intergenic
1084222670 11:67693888-67693910 AGCATTATTTTATCCCACTGCGG + Intergenic
1085692836 11:78678257-78678279 AGCATGATTTATACTCATTTGGG + Intronic
1086015497 11:82161385-82161407 AGCATGATTTATACTCATTTGGG - Intergenic
1086976839 11:93142167-93142189 AGCATGATTTATACTCATTTGGG - Intergenic
1087001628 11:93426501-93426523 AGCATGATTTATACTCATTTGGG - Intronic
1087210442 11:95441740-95441762 AGCATGATTTATACTCATTTGGG - Intergenic
1089377712 11:118006291-118006313 AGCATTCTTTCTACTCCCTGGGG - Intergenic
1090290769 11:125542134-125542156 AGCATGATTTATACTCATTTGGG - Intergenic
1093248007 12:16763956-16763978 ATCAGCATTTCTACTCACTCTGG + Intergenic
1095171205 12:39038256-39038278 ACCATCATTTTTTCTTGCTGAGG + Intergenic
1095403777 12:41844800-41844822 AGCATGATTTATACTCATTTGGG + Intergenic
1096945589 12:55405273-55405295 AGCATCTTTTCTAATCACTATGG - Intergenic
1097610904 12:61818636-61818658 AGCATCACTCTTCCTTACTGGGG + Intronic
1098315247 12:69185756-69185778 TTCATCATTTTTTCTCTCTGAGG - Intergenic
1098372362 12:69773895-69773917 AGCATGATTTATACTCATTTGGG + Intronic
1098411335 12:70187224-70187246 AGCATTATTTTCATTCATTGAGG - Intergenic
1098797865 12:74915486-74915508 AACATCATTTGTACTGAATGTGG - Intergenic
1098959869 12:76728820-76728842 AGCATCATTTACCCTCTCTGAGG + Intergenic
1099069739 12:78031036-78031058 AGCAGAATTATTCCTCACTGAGG - Intronic
1099504049 12:83450308-83450330 AGCATGATTTATACTCATTTGGG + Intergenic
1099701156 12:86083921-86083943 AGTAGAATTTTTACTGACTGTGG - Intronic
1099823656 12:87748045-87748067 AGCATGATTTATACTCATTTGGG + Intergenic
1100415163 12:94364755-94364777 AGCATCATCATGAATCACTGGGG + Intronic
1100805461 12:98278663-98278685 AGCATGATTTATACTCATTTGGG - Intergenic
1100899394 12:99220751-99220773 AGCAGCATTTCTAATCAGTGAGG + Intronic
1104172885 12:126299495-126299517 AGCATGATTTATACTCATTTGGG + Intergenic
1105052449 12:133066689-133066711 GGCATCATTTCTGCTCAGTGTGG - Intergenic
1106427116 13:29642191-29642213 AGCATGATTTATACTCATTTGGG + Intergenic
1106761063 13:32868180-32868202 AGCATGATTTATACTCATTTGGG + Intergenic
1106912748 13:34480747-34480769 AGCATGATTTATACTCATTTGGG + Intergenic
1107703052 13:43068378-43068400 ATTATCAATTTTTCTCACTGAGG - Intronic
1108813346 13:54258682-54258704 ATCAGCATTTTTACACTCTGTGG - Intergenic
1109033162 13:57219813-57219835 AGCATGATTTATACTCATTTGGG + Intergenic
1109125484 13:58512431-58512453 AGCATGATTTATACTCATTTGGG + Intergenic
1109947145 13:69450574-69450596 ACCATCAGTTTTGCTCTCTGTGG + Intergenic
1111054095 13:82925473-82925495 AGCGTCCTTGTTACTCACTTGGG + Intergenic
1111274295 13:85927439-85927461 AGCATGATTTATACTCATTTGGG - Intergenic
1111662706 13:91231311-91231333 AGCATGATTTTTACTCCTTTGGG - Intergenic
1112876758 13:104051320-104051342 AGCATGATTTATACTCATTTGGG - Intergenic
1114125478 14:19720524-19720546 AGCATGATTTATACTCATTTGGG + Intronic
1114806092 14:25838722-25838744 AGCAACTTTCCTACTCACTGAGG - Intergenic
1114997428 14:28373700-28373722 AGGATCATGTTGACCCACTGTGG + Intergenic
1115185667 14:30685294-30685316 AGCATGATTTATACTCATTTGGG + Intronic
1115293019 14:31794214-31794236 AGCATGATTTATACTCATTTGGG + Intronic
1116121697 14:40729188-40729210 AGCATGATTTATACTCATTTGGG + Intergenic
1116488284 14:45477622-45477644 AGCATGATTTATACTCATTTGGG + Intergenic
1116587485 14:46726960-46726982 AGCATGATTTATACTCATTTGGG + Intergenic
1118007756 14:61579859-61579881 AGCATCATGTTCAATCTCTGAGG - Intronic
1119439039 14:74615957-74615979 AGGACCACTTGTACTCACTGAGG - Intergenic
1120431302 14:84419198-84419220 AGCATCAGTTTGGCTCATTGGGG + Intergenic
1202919736 14_KI270723v1_random:20198-20220 AGCATGATTTATACTCATTTGGG - Intergenic
1202932262 14_KI270725v1_random:48942-48964 AGCATGATTTATACTCATTTGGG + Intergenic
1123386662 15:19817457-19817479 AGCATGATTTATACTCATTTGGG + Intergenic
1125580001 15:40778554-40778576 AGCACCAATTTTACTCACACTGG + Intronic
1127287187 15:57542166-57542188 AGCTTATCTTTTACTCACTGGGG + Intronic
1127438133 15:58978712-58978734 AGTATCATTTTTAATTTCTGAGG + Intronic
1127920369 15:63489729-63489751 AATATCATTTTTAAGCACTGAGG - Intergenic
1129974819 15:79813264-79813286 AGCTTCACCTTTACTCACTCTGG - Intergenic
1130326342 15:82883378-82883400 AGCATGATTTATACTCATTTGGG + Intronic
1131574377 15:93571912-93571934 AGGCTGATTTTCACTCACTGTGG + Intergenic
1135137431 16:19895347-19895369 AGAATCATCTGTACTCAGTGGGG - Intergenic
1136888930 16:33953062-33953084 AGCATGATTTATACTCATTTGGG + Intergenic
1137453802 16:48602600-48602622 AGAATATTTTTTACTCACTATGG - Intronic
1138238023 16:55402030-55402052 AGCATCATTTTTACTCACTGTGG - Intronic
1138703483 16:58890041-58890063 AGCATCATTCTCAGTCACTGGGG - Intergenic
1139272298 16:65695514-65695536 AGCATGATTTATACTCATTTGGG - Intergenic
1141388242 16:83642790-83642812 AGCATGATTTATACTCATTTGGG - Intronic
1141966437 16:87447886-87447908 AGTATCATTTCTATTCACCGAGG - Intronic
1143156464 17:4840458-4840480 ATCCTCATTTTTACTTACTGGGG + Intronic
1145684779 17:26641181-26641203 AGCATGATTTATACTCATTTGGG - Intergenic
1146299151 17:31674642-31674664 ATCATCATTTTTAGTTTCTGTGG - Intergenic
1147729551 17:42589781-42589803 TCCATCATTTGTATTCACTGAGG + Intronic
1151008451 17:70464481-70464503 AGCATGATTTATACTCATTTGGG - Intergenic
1153176893 18:2385350-2385372 AGCCTCAGTTTTACTCCCAGAGG + Intergenic
1155289227 18:24324033-24324055 AGCATGATTTATACTCATTTGGG + Intronic
1155405912 18:25486929-25486951 AGCATGATTTATACTCATTTGGG - Intergenic
1155437985 18:25833041-25833063 AGTATCATTTCTTCTTACTGGGG - Intergenic
1155743891 18:29325528-29325550 TTCATCATCTCTACTCACTGAGG - Intergenic
1156195223 18:34767396-34767418 AGCCCCATTTTTATCCACTGGGG - Intronic
1156837432 18:41571217-41571239 TGCATCAATTTTACTCTCTGAGG + Intergenic
1156837538 18:41572662-41572684 TGCATCAGTTTTACTCTCTGAGG - Intergenic
1156994763 18:43452022-43452044 AGCATGATTTATACTCATTTGGG - Intergenic
1157138314 18:45080671-45080693 AGCATGATTTATACTCATTTGGG + Intergenic
1158156359 18:54430075-54430097 AGCATGATTTATACTCATTTGGG - Intergenic
1159421517 18:68227112-68227134 AGCATGATTTATACTCATTTGGG + Intergenic
1159999077 18:74998855-74998877 AGCATGATTTATACTCATTTGGG - Intronic
1164553380 19:29231300-29231322 AGCATGATTTATACTCATTTGGG - Intergenic
1164603168 19:29577431-29577453 AGCATCCATTTCCCTCACTGGGG + Intergenic
1165728364 19:38128302-38128324 AGTCTTATCTTTACTCACTGAGG - Intronic
1166647968 19:44546803-44546825 AGCATGATTTATACTCATTTGGG + Intergenic
1167790301 19:51673176-51673198 AGCATGATTTATACTCATTTGGG + Intergenic
1168170069 19:54580685-54580707 AGCATGATTTATACTCATTTGGG + Intronic
925520593 2:4739254-4739276 AGCATGATTTATACTCATTTGGG - Intergenic
925654926 2:6136543-6136565 AGCATAATTTTTAATGACTCTGG - Intergenic
926230168 2:10996590-10996612 AGCATGATTTATACTCATTTGGG + Intergenic
926284065 2:11473504-11473526 AGAAGCATTCTTAGTCACTGGGG - Intergenic
928760499 2:34576005-34576027 AGCATGATTTATACTCATTTGGG - Intergenic
929398374 2:41550494-41550516 AGCATGATTTATACTCATTTGGG + Intergenic
929413582 2:41724613-41724635 AGTAACATTTTGACTCCCTGTGG - Intergenic
930738157 2:54800739-54800761 AGCAGCTTTTTTACTCTCAGTGG + Intronic
931101593 2:59008002-59008024 TGCATCTTTTTTACACAATGTGG - Intergenic
931206015 2:60146717-60146739 AGCATGATTTATAGTCATTGGGG - Intergenic
931406156 2:61980232-61980254 AGCATGATTTATACTCATTTGGG + Intronic
931934795 2:67185367-67185389 AGGGTCATTTTTACTCATTTTGG + Intergenic
933479733 2:82840600-82840622 AGCATGATTTATACTCATTTGGG - Intergenic
934109844 2:88732235-88732257 AGCATGATTTATACTCATTTGGG - Intronic
934929537 2:98410203-98410225 AGCATAAATTTTACACACTAGGG - Intergenic
935246203 2:101220589-101220611 AGCAGCAGTTTTACTCACCATGG - Intronic
936435756 2:112504297-112504319 AGCATGATTTATACTCATTTGGG + Intronic
936739475 2:115488387-115488409 AGCATGATTTATACTCATTTGGG - Intronic
938311516 2:130292196-130292218 GGCACGATCTTTACTCACTGAGG + Intergenic
939573393 2:143866481-143866503 AGCATGATTTATACTCATTTGGG - Intergenic
940380292 2:153008251-153008273 AGCATGATTTATACTCATTTGGG + Intergenic
940599541 2:155840892-155840914 AGCATAATTTTTTCCCCCTGGGG - Intergenic
941762015 2:169254150-169254172 AGCATGATTTATACTCATTTGGG - Intronic
942389981 2:175482450-175482472 AGCATGATTTATACTCATTTGGG + Intergenic
942548607 2:177091345-177091367 AGTATTTTTTTTACTGACTGTGG - Intergenic
942775498 2:179576515-179576537 AGTATCTTTTTGACTCACTAAGG + Intronic
944182565 2:196911113-196911135 AGCATGATTTATACTCATTTGGG - Intronic
944326324 2:198408814-198408836 AGAATCAGTTTAATTCACTGTGG + Intronic
945009770 2:205448620-205448642 AGCCTCATATTTAATCATTGTGG + Intronic
946099904 2:217311281-217311303 AGCATGATTTATACTCATTTGGG - Intronic
946881425 2:224180804-224180826 AGCTGCCATTTTACTCACTGCGG + Intergenic
946987192 2:225286518-225286540 AGAAACACTTTTTCTCACTGAGG - Intergenic
947412667 2:229857876-229857898 AGCAATATTCTTACTCACTTAGG + Intronic
948544610 2:238718046-238718068 AGCATGATTTATACTCATTTGGG + Intergenic
1169049451 20:2563785-2563807 TCCACCATTTTAACTCACTGTGG + Intronic
1169153742 20:3311572-3311594 AGTATCATTTTGACTCTTTGTGG - Intronic
1169778732 20:9285373-9285395 ATTATCATTTTTACTTTCTGTGG + Intronic
1169970694 20:11266680-11266702 GGCATCATTTTGATTCACAGTGG - Intergenic
1172003986 20:31804645-31804667 AGCATCATCTTTCCACACTCAGG + Intergenic
1176347813 21:5767029-5767051 AGCATGATTTATACTCCCTTGGG + Intergenic
1176354627 21:5887613-5887635 AGCATGATTTATACTCCCTTGGG + Intergenic
1176497014 21:7557426-7557448 AGCATGATTTATACTCCCTTGGG - Intergenic
1176542134 21:8165099-8165121 AGCATGATTTATACTCCCTTGGG + Intergenic
1176561085 21:8348144-8348166 AGCATGATTTATACTCCCTTGGG + Intergenic
1176659141 21:9617411-9617433 AGCATGATTTATACTCATTTGGG + Intergenic
1177560888 21:22752405-22752427 AGCATGATTTATACTCATTTGGG + Intergenic
1177699054 21:24613307-24613329 AGTATCATGTTTGTTCACTGCGG + Intergenic
1182096974 22:27632684-27632706 ATCATCACTATCACTCACTGAGG + Intergenic
1182210110 22:28668809-28668831 AGCATGATTTATACTCATTTGGG - Intronic
1182849703 22:33461833-33461855 GGCATCATTTTTCCTCTATGTGG - Intronic
1183347884 22:37318028-37318050 TGCATTCTTTTGACTCACTGGGG - Intergenic
1184106044 22:42368155-42368177 AGCACCCTTTCTCCTCACTGAGG + Intergenic
1184526551 22:45027220-45027242 AGCATGATTATAGCTCACTGCGG + Intergenic
1184532425 22:45064745-45064767 TGCGTCATTCTTAGTCACTGTGG + Intergenic
1184976288 22:48064697-48064719 AGGATCATCGTTATTCACTGTGG - Intergenic
1185123186 22:48986246-48986268 AGCATGATTTATACTCATTTGGG + Intergenic
1203247076 22_KI270733v1_random:81516-81538 AGCATGATTTATACTCCCTTGGG + Intergenic
949430332 3:3968604-3968626 AGCATGATTTATACTCATTTGGG - Intronic
949435589 3:4025782-4025804 AGCATGATTTATACTCATTTGGG + Intronic
951387079 3:22055781-22055803 AGCATGATTTATACTCATTTGGG - Intronic
951823358 3:26839164-26839186 AACATCAAATTTATTCACTGAGG - Intergenic
951846790 3:27093162-27093184 AGCATGATTTATACTCATTTGGG - Intergenic
952410521 3:33046055-33046077 AGCCTCTTTTGAACTCACTGTGG - Intronic
953120886 3:40040486-40040508 AGCATGATTTATACTCATTTGGG - Intronic
954029148 3:47805846-47805868 GGTATCATTTTTAGTCATTGTGG + Intronic
954519283 3:51209116-51209138 TGCAACATTTTTGCTCACTCTGG - Intronic
955508620 3:59657179-59657201 AACATCATTATTACTCATTAGGG - Intergenic
955841710 3:63119668-63119690 AGCATGATCTTAGCTCACTGTGG - Intergenic
955888498 3:63625676-63625698 AGCATATTTCTTACTTACTGGGG - Intergenic
955989035 3:64604972-64604994 AGGATAATTTTTAACCACTGAGG - Intronic
957487122 3:80876663-80876685 AGCATGATTTATACTCATTTGGG + Intergenic
957707215 3:83804469-83804491 AGCATGATTTATACTCATTTGGG + Intergenic
957786609 3:84890640-84890662 AGCATCATTTATAATCCCTGGGG - Intergenic
958133659 3:89461310-89461332 AGCATGATTTATACTCATTTGGG + Intronic
958202651 3:90339597-90339619 AGCATGATTTATACTCATTTGGG - Intergenic
959691756 3:109205397-109205419 AGCATGATTTATACTCATTTGGG - Intergenic
959772646 3:110118137-110118159 AGCATGATTTATACTCATTTGGG + Intergenic
960331500 3:116365520-116365542 AGCATGATTTATACTCATTTGGG - Intronic
961354264 3:126325293-126325315 AGCATGATTTATACTCATTTGGG + Intergenic
961355492 3:126337083-126337105 AGCATGATTTATACTCATTTGGG - Intergenic
961940581 3:130633559-130633581 AGCATGATTTATACTCATTTGGG - Intronic
962142760 3:132807573-132807595 AGCATGATTTATACTCATTTGGG + Intergenic
962155673 3:132946489-132946511 AGCATGATTTATACTCATTTGGG + Intergenic
962518627 3:136177367-136177389 AGCATTATTTTTAGTGACTAAGG - Intronic
962638250 3:137354095-137354117 AGCATGATTTATACTCATTTGGG - Intergenic
963285462 3:143430662-143430684 AGCATCATCTTCACTCACATTGG + Intronic
963646836 3:147925606-147925628 AGCCTCATTTATTCTGACTGTGG + Intergenic
964067209 3:152594455-152594477 AGCATGATTTATACTCATTTGGG + Intergenic
964360247 3:155888488-155888510 GGCATGATTATGACTCACTGTGG + Intronic
964489336 3:157218068-157218090 AGTATCAATTCTACTCACTAGGG + Intergenic
964568743 3:158089166-158089188 AGCCTTATTTGTACTCAATGAGG + Intergenic
964658635 3:159095848-159095870 AGCATGATTTATACTCATTTGGG + Intronic
964671980 3:159236626-159236648 AGCATCATTTACAGCCACTGAGG + Intronic
965229921 3:166037446-166037468 ATCATCATTTCTCTTCACTGAGG + Intergenic
965317003 3:167204725-167204747 AGCATGATTTATACTCATTTGGG + Intergenic
969568579 4:7994582-7994604 AGCATGATTTATACTCATTTGGG + Intronic
969903661 4:10373078-10373100 AGCATCATTTATAATCCCTTGGG - Intergenic
970308845 4:14760638-14760660 AGCATGATTTATACTCATTTGGG - Intergenic
970527641 4:16948608-16948630 AGCATGATTTATACTCATTTGGG - Intergenic
970729409 4:19085499-19085521 AGGAACATTTTTCCTCACAGAGG - Intergenic
970736006 4:19168782-19168804 AGCATGATTTATACTCATTTGGG - Intergenic
970901515 4:21164915-21164937 AGCATGATTTATACTCATTTGGG - Intronic
972369865 4:38412775-38412797 AGCATCAGTTATAATCAATGTGG + Intergenic
973143457 4:46796599-46796621 AGCATGATTTATACTCATTTGGG - Intronic
974114393 4:57562801-57562823 AGCATGATTTATACTCATTTGGG + Intergenic
974151951 4:58021629-58021651 AGCATGATTTATACTCATTTGGG - Intergenic
974303794 4:60105151-60105173 AGCATGATTTATACTCATTTGGG + Intergenic
974465526 4:62250522-62250544 AGAATCATTTTTTTCCACTGGGG + Intergenic
974658759 4:64859625-64859647 AGCATCATTTATAGTCATTTGGG + Intergenic
975085503 4:70333801-70333823 AGCATGATTTATACTCATTTGGG - Intergenic
975963717 4:79943242-79943264 AGCATGATTTATACTCATTTGGG - Intronic
975965928 4:79972427-79972449 AGCATGATTTATACTCATTTGGG - Intronic
976142771 4:82009734-82009756 AGCATGATTTATACTCATTTGGG - Intronic
976641856 4:87347608-87347630 AGCATGATTTATACTCATTTGGG + Intronic
976938942 4:90676211-90676233 AGCATGATTTATACTCATTTGGG + Intronic
977161241 4:93638792-93638814 AGCATGATTTATACTCATTTGGG + Intronic
977567182 4:98592921-98592943 AGCATGATTTATACTCATTTGGG + Intronic
977949362 4:102952452-102952474 AGCATGATTTATACTCATTTGGG + Intronic
978097201 4:104792510-104792532 AGCATGATTTATACTCATTTGGG - Intergenic
978245829 4:106571526-106571548 AGCATGATTTATACTCATTTGGG + Intergenic
978296111 4:107207156-107207178 AGCATGATTTATACTCATTTGGG + Intronic
978308275 4:107356123-107356145 AGCATGATTTATACTCATTTGGG - Intergenic
978826363 4:113028800-113028822 TGAATCATTTTTCCTCATTGTGG - Intronic
978857060 4:113405264-113405286 AACATCATTTTAACTCTCTGTGG + Intergenic
979070821 4:116204339-116204361 AGCATGATTTATACTCATTTGGG + Intergenic
979578982 4:122333114-122333136 AGCATGATTTATACTCATTTGGG + Intronic
979607394 4:122653143-122653165 AGCATGATTTATACTCATTTGGG + Intergenic
980605649 4:135084873-135084895 AGCATGATTTATACTCATTTGGG - Intergenic
980690822 4:136294002-136294024 AGCATGATTTATACTCATTTGGG + Intergenic
980865698 4:138551548-138551570 AGCATGATTTATACTCATTTGGG - Intergenic
981130531 4:141153762-141153784 GACATCATTTCTACTCTCTGTGG - Intronic
981282635 4:142976305-142976327 AGCCTAATATTTACTCACTATGG - Intergenic
981434788 4:144707831-144707853 AGCACCATTATGGCTCACTGTGG + Intronic
981613475 4:146621532-146621554 AGCATGATTTATACTCATTTGGG - Intergenic
982936074 4:161476895-161476917 AGCATCATTTTTGCTTACCCTGG + Intronic
983172717 4:164553976-164553998 AGCATGATTTATAGTCACTTGGG + Intergenic
983339953 4:166448409-166448431 AGCATGATTTATACTCATTTGGG + Intergenic
983363862 4:166761402-166761424 AGCATGATTTATACTCATTTGGG - Intronic
983827135 4:172277188-172277210 AGCAATATTTATACTCAGTGAGG + Intronic
984534446 4:180956179-180956201 AGCATGATTTATACTCATTTGGG + Intergenic
985797058 5:1970947-1970969 AGCATGATTTATACTCATTTGGG - Intergenic
985906260 5:2839783-2839805 AACATCATTTGTACACACAGGGG - Intergenic
986423173 5:7604300-7604322 AGCATGATTTATACTCATTTGGG + Intronic
986711333 5:10490012-10490034 AGCATCATTTTAGCTCTCTGAGG + Intergenic
986882925 5:12197879-12197901 AGCATGATTTATACTCATTTGGG + Intergenic
987170361 5:15250361-15250383 AGAAGCATTTGTTCTCACTGTGG + Intergenic
987232234 5:15907000-15907022 AGCATGATTTATACTCATTTGGG + Intronic
987534556 5:19166855-19166877 AGCATGATTTATACTCATTTGGG - Intergenic
987722118 5:21650541-21650563 CTCAGCATTTTTACTCACTGTGG - Intergenic
987928393 5:24371160-24371182 AGCATGATTTATACTCATTTGGG + Intergenic
988200516 5:28063284-28063306 AGACACATTTTTAGTCACTGGGG + Intergenic
988334338 5:29886526-29886548 AGCATTATTTTTATTCATGGAGG - Intergenic
988747345 5:34153363-34153385 AGCATGATTTATACTCATTTGGG - Intergenic
988843866 5:35109874-35109896 AGCATCATTTATAATCCCTTGGG - Intronic
989035066 5:37162218-37162240 AGCATTATATTTACTGACTTAGG + Intronic
989691849 5:44153951-44153973 AGCATGATTTATACTCATTTGGG - Intergenic
989719864 5:44512523-44512545 AGCATCTGTTTTACTAATTGCGG - Intergenic
989722821 5:44550204-44550226 AGAATGAATTCTACTCACTGCGG + Intergenic
990094268 5:52092064-52092086 AGCATGATTTATACTCATTTGGG - Intergenic
990101340 5:52192953-52192975 AGCATGATTTATACTCATTTGGG + Intergenic
991501381 5:67280335-67280357 ATCATCCTTTTTTCCCACTGAGG - Intergenic
993179266 5:84529398-84529420 TTCAGCATTTTTACCCACTGAGG - Intergenic
993221880 5:85109627-85109649 GGCAATATTTTTTCTCACTGGGG + Intergenic
993668472 5:90730575-90730597 AGCAATATTTTTAATCACTGTGG + Intronic
994811458 5:104524111-104524133 AGCATGATTTATACTCATTTGGG - Intergenic
994928375 5:106148425-106148447 AGCATGATTTATACTCATTTGGG + Intergenic
995185255 5:109264912-109264934 AGCATGATTTATACTCATTTGGG - Intergenic
995449248 5:112282135-112282157 AGCCTCATTTTTAGTCGCTGTGG - Intronic
996615448 5:125435892-125435914 AAAATCAGTTTTACTCAATGTGG + Intergenic
999004297 5:147959024-147959046 AGCATGATTTATACTCATTTGGG + Intergenic
999494345 5:152082363-152082385 AGCATGATTTATACTCATTTGGG - Intergenic
1000857784 5:166421052-166421074 AGCATGATTTATACTCATTTGGG - Intergenic
1001662241 5:173403281-173403303 AGCATGATTTATACTCATTTGGG + Intergenic
1001843054 5:174896450-174896472 AGCAACATTTTTACTTATTGAGG - Intergenic
1002232515 5:177777768-177777790 AGCATGATTTATACTCATTTGGG - Intronic
1003879329 6:10466018-10466040 AGCATCAACTTTTCTCCCTGGGG + Intergenic
1004272508 6:14208371-14208393 AACATCTTTTTTCCTCCCTGTGG + Intergenic
1005268600 6:24139548-24139570 AGCACCATTTTTACTCTTTTGGG + Intronic
1005337553 6:24812163-24812185 AGCATGATTTATACTCATTTGGG + Intronic
1006093522 6:31642094-31642116 AGCATCCTTTTTGCTCACCAAGG + Exonic
1006813484 6:36836144-36836166 ACAATTATTTTTACTGACTGTGG - Intronic
1007139469 6:39556061-39556083 GGCATGATCTTTACTCACTTGGG - Intronic
1007339718 6:41183093-41183115 AGGGTCATTCTTACTCACAGTGG + Intergenic
1007577381 6:42934469-42934491 AGCAACATATTTACACACTGGGG - Exonic
1008681941 6:53881740-53881762 AGTATCACTTTTTTTCACTGAGG - Intronic
1008822284 6:55648253-55648275 AGCATGATTTATACTCATTTGGG + Intergenic
1009299572 6:61997711-61997733 AGCATCATATATACTGACTCTGG + Intronic
1009582251 6:65550822-65550844 AGCATGATTTATACTCATTTGGG + Intronic
1009621084 6:66078223-66078245 AGCATGATTTATACTCATTTGGG + Intergenic
1009774076 6:68182093-68182115 AACATAATTTTTACTCAATTAGG + Intergenic
1009917666 6:70015873-70015895 AGCATGATTTATACTCATTTGGG - Intronic
1010043786 6:71418166-71418188 ACAATAATTTTTCCTCACTGTGG + Intergenic
1010292649 6:74156224-74156246 AGCATGATTTATACTCATTTGGG + Intergenic
1010848579 6:80743884-80743906 AGCATCATCGTGGCTCACTGTGG + Intergenic
1011180464 6:84613957-84613979 AGCATGATTTATACTCATTTGGG - Intergenic
1011312847 6:85999531-85999553 AGCATGATTTATACTCATTTGGG + Intergenic
1013440102 6:110156037-110156059 AGCATGATTTATACTCATTTGGG + Intronic
1013483319 6:110570657-110570679 ATCAGCATTTCCACTCACTGTGG + Intergenic
1013769004 6:113606248-113606270 AGCATGATTTATACTCATTTGGG + Intergenic
1014226054 6:118848321-118848343 AGCCTCATTTCTCCTCACTTGGG - Intronic
1014403352 6:121017979-121018001 AGCATCACCTTTTCTTACTGAGG - Intergenic
1015064226 6:129003910-129003932 AGCATGATTTATACTCATTTGGG - Intronic
1015158918 6:130129540-130129562 AAAATATTTTTTACTCACTGTGG + Intronic
1015421943 6:133021200-133021222 AGCATGATTTATACTCATTTGGG + Intergenic
1015475218 6:133652722-133652744 AGCATGATTTATACTCATTTGGG - Intergenic
1016086914 6:139925777-139925799 AGCAGCAGTTTTACTCAGCGAGG - Intergenic
1016234649 6:141848694-141848716 GGCATCCTGTTTTCTCACTGAGG - Intergenic
1016345549 6:143110066-143110088 AGGATCATTTTTTCTCACATGGG + Intronic
1017288679 6:152709343-152709365 AGCATGATTTATACTCATTTGGG + Intronic
1018098000 6:160409505-160409527 AGCATGATTTATACTCATTTGGG + Intronic
1018262370 6:161983413-161983435 AGCATGATTTATACTCATTTGGG - Intronic
1020550296 7:9595813-9595835 AGCATGATTTATACTCATTTAGG - Intergenic
1021493004 7:21240428-21240450 TGCATCATTTTTTCTAACTATGG + Intergenic
1021602372 7:22377239-22377261 AGCATCATTTTGAATTACTGAGG + Intergenic
1022442368 7:30444768-30444790 AGCATGATTTATACTCATTTGGG - Intronic
1022659263 7:32351079-32351101 AGCATGATTTATACTCATTTGGG + Intergenic
1022915988 7:34953393-34953415 AGAATCTGTTTTACTCACTGGGG - Intronic
1023516698 7:41008711-41008733 AGCGTCATTTATAGTGACTGGGG - Intergenic
1023536628 7:41219799-41219821 AGCATAATTTCTACTTAGTGAGG + Intergenic
1023755485 7:43412937-43412959 AGCATGATTTATACTCATTTGGG + Intronic
1024463155 7:49680755-49680777 AGCATGATTTATACTCATTTGGG + Intergenic
1025122438 7:56316660-56316682 ATCATCAGTTTAACTCACTGAGG + Intergenic
1025576055 7:62642638-62642660 AGCATGATTTATAATCACTTGGG - Intergenic
1025967387 7:66287338-66287360 AGCATGATTTATACTCATTTGGG + Intronic
1026418022 7:70202853-70202875 AGCATGATTTATACTCATTTGGG - Intronic
1028969855 7:96847135-96847157 AGCATGATTTATACTCATTTGGG + Intergenic
1030466357 7:109908135-109908157 AGCATGATTTATACTCATTTGGG - Intergenic
1030572360 7:111244000-111244022 AGCATGATTTATACTCATTTGGG + Intronic
1030794967 7:113776607-113776629 AGCATGATTTATACTCATTTGGG + Intergenic
1031145324 7:117991392-117991414 ATGATCATTTTTATTCTCTGAGG + Intergenic
1032105830 7:129028707-129028729 AGCAGCATCTTCACTCTCTGTGG + Intronic
1032278407 7:130480898-130480920 AGCATGATTTATACTCATTTGGG - Intergenic
1032302641 7:130702481-130702503 AGCATGATTTATACTCATTTGGG + Intergenic
1032438011 7:131917993-131918015 ATCAACATTATTACTCATTGGGG + Intergenic
1032573582 7:133028316-133028338 TGCATCATAGTTACTCTCTGAGG - Intronic
1032748377 7:134811022-134811044 AGAACCATTTATTCTCACTGGGG - Intronic
1033498208 7:141921166-141921188 AGCATGATTTATACTCATTTGGG + Intronic
1035781879 8:2234014-2234036 AGCTTCACTTTTGCTCACTTGGG + Intergenic
1035810239 8:2485392-2485414 AGCTTCACTTTTGCTCACTTGGG - Intergenic
1036175409 8:6533202-6533224 ATCATCATCTTTAGTAACTGAGG - Intronic
1036543211 8:9739562-9739584 AGCATGATTTATACTCATTTGGG - Intronic
1037354491 8:18002558-18002580 AGCATGATTTATACTCATTTGGG + Intronic
1037411048 8:18597917-18597939 AGCATGATTTATACTCATTTGGG - Intronic
1037440385 8:18910144-18910166 AGCATGATTTATACTCATTTGGG - Intronic
1038618840 8:29120663-29120685 AGCATGATTTATACTCATTTGGG + Intronic
1038831362 8:31064920-31064942 AGCAACATTTTTAATCCCTGGGG - Exonic
1038977052 8:32710908-32710930 TGCATCAGTTTGACTCACAGTGG + Intronic
1040430156 8:47332483-47332505 AGCATGATTTATACTCATTTGGG + Intronic
1041839613 8:62253630-62253652 ATCAGCATTTTTTCTCACAGTGG + Intronic
1042535868 8:69858306-69858328 GTCATCATTTCTACTCGCTGTGG + Intergenic
1042815738 8:72876041-72876063 AGCATGATTTATACTCATTTGGG + Intronic
1043128065 8:76425644-76425666 AGCATGATTTATACTCATTTGGG + Intergenic
1043335577 8:79172245-79172267 AGCATGATTTATACTCATTTGGG + Intergenic
1043686530 8:83093592-83093614 GGCATCATCTCTTCTCACTGAGG - Intergenic
1044379950 8:91522576-91522598 AGCATGATTTATACTCATTTGGG + Intergenic
1044441251 8:92227069-92227091 AGTTTCATTTTCACTCAGTGTGG + Intergenic
1045136194 8:99221272-99221294 AGCATGATTTATACTCATTTGGG + Intronic
1045976167 8:108132233-108132255 TTCATCATTTTTTCTCACTCTGG + Intergenic
1047125553 8:121955752-121955774 ACCATCATTTTTAATACCTGGGG + Intergenic
1047516306 8:125557381-125557403 AGCATCATCCTGACTCACTAGGG - Intergenic
1047790547 8:128199258-128199280 ATCATCATCCTCACTCACTGAGG - Intergenic
1047814968 8:128453474-128453496 AGCATGATTTATACTCATTTGGG + Intergenic
1048217149 8:132506745-132506767 AACCTCAATTTTATTCACTGTGG + Intergenic
1048642436 8:136379235-136379257 AACATCATTTTAAGTCACTGAGG - Intergenic
1048647506 8:136438558-136438580 AGCATGATTTATACTCATTTGGG + Intergenic
1050026369 9:1338516-1338538 AGCATGATTTATACTCATTTGGG + Intergenic
1050840037 9:10137208-10137230 AGCATGATTTATACTCATTTGGG - Intronic
1051022162 9:12557415-12557437 AGCATGATTTATACTCATTTGGG + Intergenic
1052396240 9:27941637-27941659 GGTATCATCTTTACTCCCTGTGG - Intergenic
1054761505 9:69008441-69008463 ATCACCATTTTCACTTACTGGGG - Exonic
1055643452 9:78340285-78340307 AGCATGATTTATAGTCACTTGGG - Intergenic
1055725583 9:79224706-79224728 AGCATGATTTTTCCCCTCTGGGG + Intergenic
1056280892 9:85040403-85040425 AGCAGCCTTTTTCATCACTGGGG + Intergenic
1056858305 9:90155129-90155151 AGCATGATTTATACTCATTTGGG - Intergenic
1057069319 9:92082723-92082745 AGCATGATTTATACTCATTTGGG + Intronic
1057088149 9:92229807-92229829 AGTTTTACTTTTACTCACTGGGG + Intronic
1057513713 9:95703102-95703124 AGCATGATTTATACTCATTTGGG - Intergenic
1057999845 9:99853812-99853834 AGCATGATTTATACTCATTTGGG + Intronic
1058107230 9:100986502-100986524 AGCATGATTTATACTCATTTGGG - Intergenic
1058171097 9:101682186-101682208 AGCATGATTTATACTCATTTGGG + Intronic
1059165788 9:112075315-112075337 AGTACCATTCTTACCCACTGAGG + Intronic
1059240283 9:112798612-112798634 AGCATGATTTATACTCATTTGGG + Intronic
1060673764 9:125493942-125493964 AGGAACATTTTTACTCACAGAGG - Intronic
1060886082 9:127153541-127153563 AGCATCACAAATACTCACTGAGG - Intronic
1062732195 9:138116375-138116397 ACCATCACTTTTTCCCACTGTGG + Intronic
1062742371 9:138184409-138184431 AGCATGATTTATACTCATTTGGG + Intergenic
1203450642 Un_GL000219v1:111675-111697 AGCATGATTTATACTCATTTGGG + Intergenic
1203463409 Un_GL000220v1:64577-64599 AGCATGATTTATACTCCCTTGGG + Intergenic
1203623506 Un_KI270749v1:146467-146489 AGCATGATTTATACTCATTTGGG - Intergenic
1185909285 X:3967157-3967179 AGCATGATTTATACTCATTTGGG + Intergenic
1186223657 X:7375318-7375340 AGCAACATTAGTTCTCACTGTGG + Intergenic
1186451826 X:9680352-9680374 AGCAACCTTTCCACTCACTGTGG + Intronic
1186665501 X:11712773-11712795 AGCATGATTTATACTCATTTGGG - Intergenic
1186668933 X:11749332-11749354 AGCATCTTTTTTTCACAGTGTGG - Intergenic
1186686990 X:11935768-11935790 AGCATGATTTATACTCATTTGGG + Intergenic
1189552572 X:42108636-42108658 GGCTTCATTTTTATTCACTGTGG + Intergenic
1189661666 X:43306684-43306706 AGCATGATTTATACTCATTTGGG + Intergenic
1190394490 X:49967100-49967122 AGCATGATTTATACTCATTTGGG + Intronic
1190838003 X:54119198-54119220 AGCATGATTTATACTCATTTGGG + Intronic
1190975409 X:55395470-55395492 TCCATCTTTTTTATTCACTGAGG - Intergenic
1191098671 X:56701410-56701432 AGCATGATTTATACTCATTTGGG - Intergenic
1192080458 X:68042878-68042900 AGCATGATTTATACTCATTTGGG - Exonic
1193060853 X:77205591-77205613 AGCATGATTTATACTCATTTGGG + Intergenic
1193179849 X:78441817-78441839 AGCATGATTTATACTCATTTGGG + Intergenic
1193465866 X:81846678-81846700 AGCATGATTTATACTCATTTGGG - Intergenic
1193836873 X:86354326-86354348 AGCATGATTTATACTCATTTGGG - Intronic
1194071288 X:89329053-89329075 AGCAGCATTCTTTCTCACAGTGG - Intergenic
1194575003 X:95601627-95601649 AGCATGATTTATACTCATTTGGG - Intergenic
1194725995 X:97398128-97398150 AGCATCTTTTTAAAACACTGGGG - Intronic
1196052007 X:111315586-111315608 AGCATGATTTATACTCATTTGGG - Intronic
1196227322 X:113181349-113181371 AATATCATTTTTACCCATTGGGG - Intergenic
1196472738 X:116047388-116047410 AGCATGATTTATACTCATTTGGG + Intergenic
1196787766 X:119435953-119435975 AGCATGATTTATACTCATTTGGG + Intronic
1196991968 X:121339766-121339788 AGCCTCATGGTTAATCACTGAGG - Intergenic
1197021740 X:121698170-121698192 AGCATGATTTATACTCATTTGGG - Intergenic
1197423490 X:126267023-126267045 AGCATGATTTATAATCATTGGGG + Intergenic
1197583020 X:128309491-128309513 AGCATTTATTTGACTCACTGTGG - Intergenic
1197860445 X:130964452-130964474 AGCATGATTTATAGTCACTTGGG - Intergenic
1197864736 X:131006014-131006036 AGCATGATTTATACTCATTTGGG - Intergenic
1198893092 X:141421700-141421722 AGCATGATTTATACTCATTTGGG + Intergenic
1198988519 X:142483367-142483389 AGCATGATTTATACTCATTTGGG - Intergenic
1199422424 X:147659260-147659282 AGCATGATTTATACTCATTTGGG - Intergenic
1199998053 X:153039208-153039230 AGGGTCATTTTTGCTCAGTGTGG + Intergenic
1200368986 X:155701096-155701118 AGCATGATTTATACTCATTTGGG + Intergenic
1200632419 Y:5606653-5606675 AGCATGATTTATACTCATTTGGG + Intronic
1201539212 Y:15088142-15088164 AGCATCATTTATAGTCATTTGGG + Intergenic
1201706044 Y:16938249-16938271 GGCATGATATTGACTCACTGCGG + Intergenic
1202348178 Y:23957356-23957378 AGCATGATTTATACTCATTTGGG + Intergenic
1202522596 Y:25712748-25712770 AGCATGATTTATACTCATTTGGG - Intergenic