ID: 1138238027

View in Genome Browser
Species Human (GRCh38)
Location 16:55402048-55402070
Sequence ATGCTGTTATAGGTGGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138238023_1138238027 -5 Left 1138238023 16:55402030-55402052 CCACAGTGAGTAAAAATGATGCT 0: 1
1: 0
2: 0
3: 20
4: 457
Right 1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG 0: 1
1: 0
2: 1
3: 11
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138238027 Original CRISPR ATGCTGTTATAGGTGGGACA TGG Intronic
903413420 1:23165755-23165777 ATGCTGTTACAGGTAGGACCCGG - Intronic
905771412 1:40640341-40640363 AAGCTATTATAGGTGGGGAAGGG - Intronic
906780688 1:48570383-48570405 GGGCTGTGAGAGGTGGGACAGGG + Intronic
907294465 1:53440706-53440728 ATTCTGTTATAGGCTGGGCACGG - Intergenic
910067853 1:83174811-83174833 ATGGTGTTAAAGGAGAGACAAGG + Intergenic
912792504 1:112665973-112665995 ATCCTATTATAGGTGACACACGG - Intronic
913522303 1:119656389-119656411 ATGCTGTGAAAGGTGGGACAGGG + Intergenic
914720731 1:150286726-150286748 ATGCTGTAGTAGGTGGGACTGGG - Exonic
915730851 1:158053135-158053157 ATGCAGTTATAGGTGTGATATGG - Intronic
915939503 1:160109767-160109789 CCGCTGTGAGAGGTGGGACAGGG - Intergenic
916628542 1:166586649-166586671 CTGCTGTTATAGGTTGAAAATGG - Intergenic
916751715 1:167728973-167728995 ATGCTGTTATCGGCCGGGCATGG + Intronic
916877990 1:168990854-168990876 ATGCTGCTATGGCAGGGACAGGG - Intergenic
919305076 1:195822064-195822086 ATGCTTTTTTAGGTCGGGCACGG + Intergenic
923279544 1:232429881-232429903 ATGCAGTTATTGGTAGGACCTGG - Intronic
1064566883 10:16648873-16648895 ATGCTTTTATAGTTGTGACTTGG - Intronic
1071514302 10:86286986-86287008 ATGCTCTTATAGGCTGGTCAGGG + Intronic
1073024089 10:100473634-100473656 ATTCTATTATGGGTTGGACATGG + Intronic
1075581501 10:123622060-123622082 ATGTTTTTATATGTGGGACATGG - Intergenic
1083704560 11:64505145-64505167 ATCTTGTTCTAGGAGGGACAGGG - Intergenic
1088092816 11:106063317-106063339 AAGCTTTTATAGGTTGAACATGG - Intronic
1093102316 12:15041913-15041935 ATGATGTTATAAGGGAGACATGG + Intergenic
1094383472 12:29868587-29868609 ATGCTGTGATAGGCAGGATATGG - Intergenic
1096936529 12:55286124-55286146 ATGGGGTTAGAGGTGGGAGATGG - Intergenic
1097399401 12:59110545-59110567 ATGGTGCTACAGGAGGGACAGGG + Intergenic
1100613534 12:96212568-96212590 ATGTTGTTATAGGGGGGAGGTGG + Intronic
1105607940 13:21942718-21942740 AGGCAGTTACAGGTGAGACAGGG - Intergenic
1107174804 13:37387985-37388007 ATGCTGTTTGAAGTGGGAAAGGG - Intergenic
1111157815 13:84351416-84351438 ATCCTGTTCTAGGAGGGACAAGG + Intergenic
1112931236 13:104740898-104740920 ATGCTGTGCTTGCTGGGACAGGG + Intergenic
1115613398 14:35070312-35070334 ATATTGTTATAGGCCGGACACGG - Intronic
1116056475 14:39870591-39870613 ATGCTGAGAGAAGTGGGACAGGG + Intergenic
1116647169 14:47543201-47543223 CTGCTGTTGTCGCTGGGACAGGG - Intronic
1117648028 14:57872948-57872970 ATGCTGTGATTGGTGGAGCAGGG - Intronic
1119955240 14:78791140-78791162 ATGTTGTTTTAGGTGTGATAAGG - Intronic
1120061653 14:79990421-79990443 ATGATGTTATAGGTTGGAGGAGG + Intergenic
1120595211 14:86425799-86425821 ATACTTTTATAAGTGGGAAACGG + Intergenic
1121529451 14:94641967-94641989 ATGCTGTGATGGGTGGGGCTAGG - Intergenic
1128463913 15:67892357-67892379 ATGCTGTTATAGGTAGTGTAGGG + Intergenic
1129207370 15:74045067-74045089 ATGCTGTGATGGGTGGGGCCTGG - Exonic
1129790184 15:78335978-78336000 TTGCTGCTATAGGTAAGACATGG - Intergenic
1130142873 15:81245594-81245616 CTGCTGGCATGGGTGGGACAGGG + Intronic
1131308195 15:91264408-91264430 AGGCTTTTATAGGTCGAACATGG + Intronic
1132509868 16:334165-334187 GTGCTGTTATTGGTGTGCCATGG - Intronic
1133482360 16:6183563-6183585 ATGCTGTTATATATGAGAGAGGG + Intronic
1137464102 16:48692375-48692397 AGGCTGTTCTAGCAGGGACAGGG - Intergenic
1137480865 16:48850740-48850762 ATGCTTTTATAAGGGGGAGAAGG + Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1142379696 16:89724254-89724276 ATGTTGTTTTAGGAGGGCCAGGG + Intronic
1144129694 17:12234292-12234314 AGGCTGTTTTAGGTGAGATAGGG + Intergenic
1148144618 17:45355195-45355217 AGGATGTTGGAGGTGGGACAAGG + Intergenic
1149898554 17:60451227-60451249 ATGATGTTAAAGGTAGGAGAAGG + Intronic
1152881428 17:82818269-82818291 ATTCTGTTCCTGGTGGGACATGG + Intronic
1153019160 18:611155-611177 GAGCTGTAATAGGTGGCACAGGG - Intronic
1153249675 18:3108827-3108849 ATGCTGTCATTGGCCGGACACGG - Intronic
1155521077 18:26669719-26669741 ATGCTGGTCTAGGTTGGGCATGG + Intergenic
1156663857 18:39381892-39381914 ATTCTGATATATGTGGCACAAGG - Intergenic
1159077521 18:63698689-63698711 CTGCTGTTATAGGTAAGAAATGG - Intronic
1159219267 18:65438646-65438668 ATGCTCTTACAGGAGGCACAAGG - Intergenic
1163769366 19:19181355-19181377 ATGTTTTTAAAAGTGGGACAAGG + Intronic
925866471 2:8232377-8232399 ATGCTGGAACTGGTGGGACAGGG - Intergenic
929520354 2:42644493-42644515 ATGCTATTATAGGTGTGGCCTGG + Intronic
931078391 2:58741967-58741989 ATGATGATATAGGTTGTACATGG + Intergenic
935847692 2:107184706-107184728 ATCCTGTTATTGGTGATACAGGG - Intergenic
936257129 2:110926711-110926733 ATGTGGTAATTGGTGGGACAGGG - Intronic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
937701258 2:124865608-124865630 ATGCTGATACTGGTGGGACATGG - Intronic
939678743 2:145104625-145104647 CTGCTGTTTTAGAGGGGACAAGG + Intergenic
940324704 2:152412906-152412928 CTGCTGTTATAGGTCAGAAATGG + Intronic
942408898 2:175685866-175685888 GTGCTGTGCTAGGTGGGACATGG - Intergenic
942506062 2:176642803-176642825 TGGCTGTTATTGCTGGGACAGGG + Intergenic
942636301 2:178010331-178010353 ATGCTATTGAACGTGGGACAAGG + Intronic
943112868 2:183627541-183627563 ATGTTGATATAGGAGGGAGAGGG + Intergenic
943268077 2:185763128-185763150 AAGCTGATATTGCTGGGACAAGG - Intronic
944475844 2:200105156-200105178 ATGCTTTTATAGCTTGGAAAAGG - Intergenic
946237112 2:218330785-218330807 ATTCTAATATAGGTGGGCCAAGG + Intronic
948667383 2:239545253-239545275 GTGCTGTTATAGGAGGGAGTAGG - Intergenic
948738752 2:240028893-240028915 CTGCTGGGACAGGTGGGACAGGG + Intergenic
1168980579 20:2000151-2000173 ATGCTGGTATAGGCTGGGCATGG - Intergenic
1170145151 20:13165300-13165322 ATGCTTTTATGAGTGGAACAAGG - Exonic
1172866664 20:38105082-38105104 ATGCTGGTATAGATGGAACGGGG + Intronic
1173250546 20:41362194-41362216 ATGCTGTCTGAGGTTGGACATGG - Exonic
1174483588 20:50847750-50847772 ATTCAGTTACAGGTGGGACACGG + Intronic
1174682397 20:52421217-52421239 AGGCTGTTATAGGGGAGGCAGGG + Intergenic
1175288061 20:57851062-57851084 ATGCTGGTAGAGTTGGGGCATGG + Intergenic
1176253448 20:64138138-64138160 ATGCTGGGATAGATGGGGCAGGG + Intergenic
1177671030 21:24227707-24227729 ATGCTGTTAGAGTTTGGATAGGG + Intergenic
1180204139 21:46246876-46246898 ATGCTGTTGCAGGTGGCCCATGG - Exonic
950869121 3:16213589-16213611 ATGCTGTTTAATGTGGGAAATGG + Intronic
952207830 3:31198198-31198220 ATACAGTGATAGGTGGGGCATGG - Intergenic
958268923 3:91473979-91474001 ATGTTGTTATAATTGGGTCAAGG - Intergenic
959620837 3:108397232-108397254 ATGCTGAGATAGGTGGGGCCAGG - Intronic
960181743 3:114588135-114588157 ATTCTGTTTTAGGTGGGGGAAGG + Intronic
960657576 3:120022868-120022890 ATCCTCTTATTGGTGGGTCATGG + Intronic
970106910 4:12595461-12595483 ATGCTTCTTTAGGTGGGACCTGG + Intergenic
970882776 4:20951135-20951157 ATGCATGTATAGGTGGGGCAGGG - Intronic
974850819 4:67403370-67403392 ATTCTGTTCTAGGAGGAACAAGG + Intergenic
978174913 4:105718240-105718262 ATGTTGTTGGAGGTGGGACCTGG + Intronic
978810089 4:112840097-112840119 CTGCTGTTAGAGGAAGGACAAGG - Intronic
978952290 4:114575461-114575483 ATGCTGTTATAGGCAGGGCATGG - Intergenic
989068870 5:37490008-37490030 AGGCTGTGGTAGGTGGGACGGGG + Intronic
997312999 5:132905193-132905215 ATGCTGTTATAGGGCTTACATGG - Intronic
999107433 5:149086188-149086210 AGGCTGTTATAGGTGTGAAAAGG - Intergenic
1001057706 5:168462953-168462975 ATGCTCTTCTAGGTTGAACATGG - Intronic
1001513259 5:172338167-172338189 ATGCTGTGATAGGAGGGATCAGG + Exonic
1002099733 5:176851474-176851496 ATGCCGCCATATGTGGGACAGGG + Intronic
1002549913 5:179980309-179980331 ATTCTCTTATATGTAGGACATGG - Intronic
1002699260 5:181111023-181111045 ATGCTGCTCAAGGTGGGCCAAGG - Intergenic
1002902088 6:1417660-1417682 ATGCAGTTGGAGCTGGGACATGG - Intergenic
1008986306 6:57547758-57547780 ATGTTGTTATAATTGGGTCAAGG + Intronic
1009174267 6:60440320-60440342 ATGTTGTTATAATTGGGTCAAGG + Intergenic
1010363439 6:75021966-75021988 ATGCTGTTATATGTAATACAAGG + Intergenic
1015073815 6:129130545-129130567 ATGCTGATAGTGGTGAGACATGG + Intronic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1019613346 7:1947876-1947898 TTCCTGGAATAGGTGGGACACGG - Intronic
1021297638 7:18928165-18928187 ATGCTGTAGTAGGTTGAACAGGG - Intronic
1023851412 7:44152353-44152375 ATGCTGGTGAAGGTGGGAGAAGG - Exonic
1024050381 7:45617413-45617435 CAGCTGTGATAGGTGGGACTGGG + Intronic
1024822693 7:53351971-53351993 AAGCTTTAATAGATGGGACACGG + Intergenic
1029269082 7:99365753-99365775 ATCCTGTTTCAGGTGGGGCAGGG + Intronic
1031092955 7:117384277-117384299 TTGCTCTTATATGTGTGACAGGG - Intronic
1033971956 7:147052450-147052472 ATTCTTTTATTGGTGGAACAGGG + Intronic
1034392436 7:150797238-150797260 ATGCTGCTATTTGTGGGAAAAGG - Intronic
1035787305 8:2271866-2271888 ATTCTGTTATGGGCGGGGCAGGG + Intergenic
1035805502 8:2449850-2449872 ATTCTGTTATGGGCGGGGCAGGG - Intergenic
1036632118 8:10523301-10523323 ATGATGATATAGGTCGGATATGG - Intergenic
1036697884 8:10990596-10990618 TTGCTGTTATTGCTGAGACAGGG + Intronic
1038134285 8:24768838-24768860 CAGCTGTCAGAGGTGGGACAGGG + Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041654796 8:60337926-60337948 ATGCTGTTAAATGTTTGACATGG - Intergenic
1045847997 8:106659499-106659521 ATCCTCTTAAAGGTGGGACCAGG + Intronic
1048425071 8:134315895-134315917 ATGCAGTAATTGGTGGGAAATGG + Intergenic
1049244540 8:141555104-141555126 ATGGTGTTAAAGGTGGTTCATGG + Intergenic
1052842053 9:33300351-33300373 AGGCTGTAACAGGTTGGACACGG - Intronic
1057325922 9:94063141-94063163 ATGCTGTATCATGTGGGACAAGG + Intronic
1057630803 9:96717582-96717604 ATGCTTATGTAGGTGGGGCACGG - Intergenic
1061934352 9:133849211-133849233 ATGCTATTATACTTGGGACAGGG + Intronic
1186900100 X:14045340-14045362 ATACTGCTATAGATGGGGCAGGG - Intergenic
1187424886 X:19168170-19168192 ATCCTGATATAGGTGGCCCAAGG + Intergenic
1187715424 X:22097709-22097731 ATGGTGTTTTAGGTAGGATAGGG + Intronic
1187977445 X:24717479-24717501 ATGCTCTTACAAGTAGGACACGG - Exonic
1188099160 X:26061435-26061457 ATGCTGATAAAGGGTGGACAGGG + Intergenic
1191043792 X:56114111-56114133 CTGCTTCTATAGGTGGGACCCGG - Intergenic
1192845362 X:74901719-74901741 ATGCTATCATAGCTGGGAGAAGG - Intronic
1193928370 X:87520082-87520104 ATGGTTTTATAGGTGTGCCAAGG + Intronic
1196603292 X:117626393-117626415 CTGATGTAATAGGTGGGATAGGG - Intergenic
1202058371 Y:20859726-20859748 ATGCTGTTATAAGTGTGGAAAGG + Intergenic