ID: 1138238291

View in Genome Browser
Species Human (GRCh38)
Location 16:55404415-55404437
Sequence ACTTTGTTAGAGATGCTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138238288_1138238291 15 Left 1138238288 16:55404377-55404399 CCTATCACTTGAGCAAAAATTCA 0: 1
1: 0
2: 2
3: 17
4: 281
Right 1138238291 16:55404415-55404437 ACTTTGTTAGAGATGCTACAGGG 0: 1
1: 0
2: 1
3: 15
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138238291 Original CRISPR ACTTTGTTAGAGATGCTACA GGG Intronic
902822745 1:18953516-18953538 GCTTTCTTAGAGATGCTTTAGGG - Intronic
906035091 1:42745837-42745859 ACTGTGCTTGAGATGCCACAGGG - Intergenic
906138153 1:43515046-43515068 CCTTTGGGAGAGATGCTAAAGGG - Intergenic
907854543 1:58289265-58289287 TCTTTATTAGAGATGCTAAGAGG - Intronic
909315611 1:74214166-74214188 ATATTGTTCCAGATGCTACAAGG + Intronic
909465498 1:75969527-75969549 GCTTTGTTAGGGAAACTACAGGG + Intergenic
909506290 1:76393986-76394008 ACTTTGTTTAAGATGCTCTATGG - Intronic
911410054 1:97492828-97492850 ATTTTGTTAGAGATACTTCTGGG - Intronic
912651223 1:111441344-111441366 ACTTTGTGAGAGATGCGACTTGG - Exonic
915802867 1:158813118-158813140 ACATTGTTGGAGAGGCTGCAAGG + Intergenic
920602269 1:207339744-207339766 ATTTTTTTAGGTATGCTACATGG - Intronic
921811653 1:219521474-219521496 ATTTTGGTACAGATGCTATAAGG - Intergenic
921908667 1:220524327-220524349 ACTTTGTTTTAGGTACTACAAGG - Intergenic
924439725 1:244076249-244076271 ACTTTGTTAGGGAAGCTAGCAGG - Intergenic
1065911233 10:30307864-30307886 ACTTTCTGATAGTTGCTACATGG + Intergenic
1069328792 10:67265212-67265234 ACTTTGTGATAGAAGCTATAAGG - Intronic
1074314991 10:112353052-112353074 CCTTTATTAGAGATTCAACAGGG + Intergenic
1074708357 10:116156160-116156182 TCTTGGTTAGAGATTCTAGATGG + Intronic
1075646009 10:124096943-124096965 ATTCTGTAAGAGATGCTACAAGG + Intergenic
1076226358 10:128779332-128779354 TCTGTTTTAGAGATGATACAAGG + Intergenic
1079380357 11:19932699-19932721 TCTTTTTTAAAGATTCTACATGG + Intronic
1081561548 11:44221643-44221665 ATTGTGATAGAGATGCTCCAAGG + Intronic
1082728285 11:56763942-56763964 ATTTTGTTAGAGAGGGAACATGG - Intergenic
1084905712 11:72345030-72345052 ACTCTGTTGGAGAGGCTACAAGG + Intronic
1085180363 11:74530054-74530076 ACTTTGTAAGAAATGCTAAAGGG - Intronic
1087249511 11:95881501-95881523 ACTTTATTAAAGAAGCTAAAAGG - Intronic
1087703135 11:101459601-101459623 ACATTTTTAGAGAAGCTACAGGG + Intronic
1090777576 11:129978904-129978926 AGTTTGTTAGCGATGCATCAGGG + Intronic
1091667012 12:2426321-2426343 AGTGTGTGAGAGATGCCACAAGG + Intronic
1092596500 12:10011156-10011178 ACCTTGTTAGAGATGCCAGGAGG + Intronic
1092893762 12:12993781-12993803 ACATTGTTACAGGTGCTATAAGG + Intronic
1093358917 12:18200567-18200589 CCTGTCTTCGAGATGCTACAGGG + Intronic
1093876163 12:24351960-24351982 ACTTTGTGAAAGATTCTAAAGGG + Intergenic
1101306884 12:103537133-103537155 ATTTTGTTAGAAATAATACATGG + Intergenic
1101580193 12:106036040-106036062 ATTTTGTAAGAGATGCAACAGGG + Intergenic
1105391141 13:19979575-19979597 AATCTGTGATAGATGCTACAGGG + Intronic
1109202303 13:59444461-59444483 ACTTTGTTAGAGAGTCCTCAAGG + Intergenic
1110370027 13:74729513-74729535 ACTCTGGAAGAGATGATACATGG + Intergenic
1111135315 13:84034037-84034059 ACTGCCTTAGAGATTCTACAGGG - Intergenic
1114038305 14:18650392-18650414 ACTTGCTTAAAGATGTTACAGGG - Intergenic
1114120316 14:19664650-19664672 ACTTGCTTAAAGATGTTACAGGG + Intergenic
1118468875 14:66056615-66056637 TCTTTGTAATAAATGCTACAAGG - Intergenic
1120698432 14:87670793-87670815 ACTGTGTTACATATACTACATGG + Intergenic
1123126897 14:105953312-105953334 CATTTGTTATAGATGCTAAAAGG + Intergenic
1123407362 15:20029151-20029173 CATTTGTTATAGATGCTAAAAGG + Intergenic
1123516689 15:21035807-21035829 CATTTGTTATAGATGCTAAAAGG + Intergenic
1124784342 15:32665404-32665426 ACTTTCTGAAAGATGCAACATGG + Intronic
1124854480 15:33374078-33374100 GCTTTGTTAGAGATTTAACAGGG - Intronic
1125356269 15:38820140-38820162 AATTTGTTATAGAAGCAACAGGG - Intergenic
1128263813 15:66251747-66251769 ACTTGCTTAGAGCTGCTATACGG - Intronic
1128336373 15:66788324-66788346 AATAGGTTAGAGAGGCTACAAGG - Intergenic
1131894388 15:97009916-97009938 ACTTTTTTTGAGATGAGACATGG + Intergenic
1138067808 16:53960127-53960149 ACTTTGTTAAAGATGCAATGGGG + Intronic
1138238291 16:55404415-55404437 ACTTTGTTAGAGATGCTACAGGG + Intronic
1138672191 16:58624397-58624419 ACTGTGTTACAGTTGTTACAGGG - Intronic
1139808737 16:69593613-69593635 ACTTTGTTAGAAATGTAACTAGG - Intronic
1140959012 16:79894840-79894862 ACTTTGTTATACATGGTAAAGGG + Intergenic
1143896323 17:10139219-10139241 AATTGGTTATAGATGATACATGG - Intronic
1145136473 17:20413645-20413667 ACTTTGTTTGAGAATCTACCAGG + Intergenic
1149425181 17:56548119-56548141 ACTTTGTTTGTGATGCATCATGG - Intergenic
1156839320 18:41592598-41592620 GCTTTGTTGCAGATGCTATAGGG - Intergenic
1157294416 18:46432526-46432548 ACCTTTTTAAAGATGCCACATGG - Intronic
1158083149 18:53617869-53617891 ACTCTTTGAGAGATGGTACAGGG - Intergenic
1158875769 18:61733188-61733210 TCCTTGTTAGAGATGCTCCAGGG - Intergenic
1160732164 19:646216-646238 CCTTTGTCAGAGATGCTGCCGGG - Intergenic
1163172073 19:15538380-15538402 ACTTTCTGAGAGATGCTTTAAGG + Intronic
925184764 2:1839417-1839439 ACTTTGTTACAGAAGCCACCAGG - Intronic
925806298 2:7652947-7652969 ACTTTCTTAGAGATTCCTCATGG + Intergenic
925931535 2:8712085-8712107 TCTGTGTTAGACATGCTGCACGG + Intergenic
928381983 2:30825887-30825909 ACCTTGTCAGAGATGCTATCTGG + Intergenic
928459094 2:31452979-31453001 ACCCTGTAAGAAATGCTACAGGG + Intergenic
928871880 2:35989904-35989926 GCTTTGATAGAGCTGCCACAGGG + Intergenic
929224585 2:39500002-39500024 AGTTTGTTAAAGAGGTTACACGG - Intergenic
929459943 2:42096158-42096180 AATTTGTTAGAGATGGTGCTGGG - Intergenic
930065103 2:47321871-47321893 ACTTTCTTCCAGAAGCTACAGGG + Intergenic
932535498 2:72589407-72589429 ACTTTGTTGAAGATGGTAGAAGG - Intronic
933008320 2:77023583-77023605 ACTTTGAGAGAGATGATTCAGGG - Intronic
933537792 2:83598357-83598379 ACCTTATGAGAGATGCTAAAGGG + Intergenic
933886913 2:86726947-86726969 ATTTTGTTGGAGATACTCCAGGG + Intronic
933923265 2:87069761-87069783 ATTTTGTTGGAGATACTCCAGGG - Intergenic
938443579 2:131357407-131357429 ACTTGCTTAAAGATGTTACAGGG - Intergenic
938889527 2:135689429-135689451 ACTATGTTTTAGATGCTAAATGG + Intronic
940183382 2:150958212-150958234 ACTGTCCTTGAGATGCTACAGGG + Intergenic
941353796 2:164464874-164464896 TCTTTGTTTGTGATGCTATAAGG + Intergenic
941899689 2:170666243-170666265 ACTTTATTAGAGGTCCTCCATGG - Intergenic
942687628 2:178550065-178550087 TATTTGTTAGAGATGCTACTCGG - Exonic
944405918 2:199383445-199383467 AATATGTTAGACATGTTACATGG - Intronic
946268706 2:218570905-218570927 AATTTGTCAGAGCTGCTACGAGG - Intronic
947474432 2:230430468-230430490 ACTTTATCAGAGTTGCTACCAGG + Intronic
1169057020 20:2631425-2631447 ACTCTGTAAGAAATGCTAGAGGG - Intronic
1171004786 20:21453863-21453885 ACTTTGCTAGAGATGCCTCAGGG + Intergenic
1177710303 21:24765082-24765104 ACTTTGGTATACATGCTGCAGGG - Intergenic
1180133904 21:45848079-45848101 CCTTTGTTCGAGATGCCACCTGG - Intronic
1180462426 22:15577433-15577455 ACTTGCTTAAAGATGTTACAGGG - Intergenic
1182946887 22:34332579-34332601 ACTTTCATAGTGATGCCACAGGG - Intergenic
1184353155 22:43958345-43958367 ACTTTGTTCAAGATGCCACAGGG - Intronic
1185061332 22:48608440-48608462 ACTTTGTAAGAGAGGCTCCCAGG - Intronic
949138518 3:601855-601877 AATTTGTTTCATATGCTACATGG + Intergenic
949240991 3:1871401-1871423 TCTTTGGTAGTCATGCTACAGGG - Intergenic
952568941 3:34690496-34690518 ACTTTGTTACAGCTCCAACAAGG + Intergenic
954341686 3:49959103-49959125 ACCTTGTAAGAAATGCTAAAAGG - Intronic
957406076 3:79776244-79776266 ACATTGTTAGGGCTGCTACCTGG + Intergenic
957669470 3:83281608-83281630 ACTTTGTGAGAGATGATTTAGGG - Intergenic
958011879 3:87889576-87889598 TCTGGGTTTGAGATGCTACAAGG + Intergenic
960204885 3:114884880-114884902 GGTTTGTTAGAGGAGCTACAGGG - Intronic
961058491 3:123808977-123808999 ACATTGTTAGAGATGCCACACGG + Intronic
961615072 3:128172779-128172801 ACTTTGCTGCAGATGCTCCAAGG - Intronic
964773560 3:160251237-160251259 ACTTTGTTAGAGACTGTAAAAGG + Intronic
966276822 3:178182750-178182772 ATATTTTTACAGATGCTACAGGG - Intergenic
967774097 3:193368243-193368265 ACTTTGTTAGAATTATTACAAGG - Intronic
975660582 4:76684775-76684797 ACTGTGATAGAGATGTTAAAAGG + Intronic
975818855 4:78248539-78248561 ACTTTGTTTGTGAGGCTAAAAGG + Intronic
976904961 4:90226039-90226061 ACCCTATTAGAGATGCTGCAAGG + Intronic
978393568 4:108253409-108253431 ACAGTGTGAGAGATGTTACAAGG - Intergenic
979219640 4:118207670-118207692 ACCTTGTTAGGGAAGGTACATGG - Intronic
979349553 4:119628519-119628541 ACTTTGTTAGAAAAGCCACCAGG - Exonic
980654422 4:135764120-135764142 ACTTTGTTTCAGGGGCTACATGG + Intergenic
982651478 4:158093007-158093029 GCTTTGTTAGAAATGCTTCTAGG - Intergenic
987782888 5:22462133-22462155 AATTTCTTAGAGATCTTACAAGG + Intronic
987830101 5:23084836-23084858 ACTTTGTGAGATATGCATCATGG - Intergenic
990624570 5:57597149-57597171 ACTTTGTTATAGCAGCTATAGGG - Intergenic
991058206 5:62342630-62342652 ACTTTGTTAGATCTGCATCAAGG + Intronic
991306937 5:65186882-65186904 ACTGTGTTTAAGATGGTACATGG - Intronic
992061137 5:73048820-73048842 ACTCTGTTAGTGAAGCTGCAGGG - Intronic
992697277 5:79302625-79302647 ACATTGTAAGACATGCTGCAGGG + Intronic
994328877 5:98482503-98482525 AATTTGTTACAGCTGCAACAGGG + Intergenic
995043401 5:107616108-107616130 ACTTCATCAAAGATGCTACATGG - Intronic
995671875 5:114613481-114613503 ACTGTGTGAGAGAAGATACAGGG + Intergenic
998324506 5:141268036-141268058 ATTTTGTTAGAAATGCTTTACGG + Intergenic
1000484167 5:161818890-161818912 ACTTTGTCTGAGATGCTCCTCGG + Intergenic
1009004001 6:57759104-57759126 GATTTGGGAGAGATGCTACACGG - Intergenic
1011660847 6:89592634-89592656 ACCTTGTTAGAGAGGCCAAATGG - Intronic
1012182167 6:96167841-96167863 ACTGTGCTCAAGATGCTACATGG + Intronic
1012343739 6:98160295-98160317 ACTTTGTTAGATTTGTTACTAGG - Intergenic
1012716467 6:102679107-102679129 ATTTTTTTAGAAATGCTTCAAGG + Intergenic
1014403845 6:121024272-121024294 CCTTTCTTAGAGATTCTACTAGG - Intergenic
1015017367 6:128429991-128430013 AGTTTGTAAGAGATTTTACATGG + Intronic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1016701524 6:147059542-147059564 ACTTTGTCAGAAATGTTAAAGGG + Intergenic
1017185796 6:151598979-151599001 ACTTTGTTAGAGAGAATAAAGGG + Intronic
1018711388 6:166500280-166500302 ATTTTGTTGCAGATGCTATAGGG + Intronic
1019627893 7:2030398-2030420 GCTTTGTTCGAGCTGCTATACGG - Intronic
1020110847 7:5446941-5446963 ACTTTGCTAAAGAGGATACAGGG + Intronic
1022029980 7:26483714-26483736 ACTTTTCTGGAGTTGCTACAGGG + Intergenic
1026388256 7:69873670-69873692 GATTTGTTAGAAATGCTGCAAGG + Intronic
1028806149 7:95027598-95027620 ACGTTCTGAGAGATGCTTCAAGG + Intronic
1030578267 7:111317895-111317917 AATTTGTTATAGATTCTACATGG + Intronic
1030636262 7:111952892-111952914 GCTTTTTCAGATATGCTACATGG - Intronic
1031963559 7:128010906-128010928 CCTCAGTTAGAGATGCTACAGGG - Intronic
1032293736 7:130615440-130615462 TCTTCGTTATAGATGCTAAAGGG + Intronic
1038295440 8:26287693-26287715 ACTATGTTTGAAATGCTAAATGG + Intergenic
1040681806 8:49819987-49820009 CCTTTGTCAGAGATGCTAATTGG + Intergenic
1042660506 8:71149509-71149531 ACATGTTTAGAGATGGTACAAGG + Intergenic
1044854595 8:96462109-96462131 ACTTTATTACAGATGCTAAATGG - Intergenic
1045129595 8:99134930-99134952 ACTAATTTAGAGATTCTACAAGG + Intronic
1045214760 8:100136936-100136958 ACTCGGTTAGAAATGCTATAAGG + Intronic
1048469689 8:134695692-134695714 CCTTGGTTAGAGATGCTGCCTGG - Intronic
1050203250 9:3171325-3171347 ACTTGGGTAGAGATGACACAGGG - Intergenic
1056558088 9:87706492-87706514 ACCTTGTGAAAGATGCCACATGG - Exonic
1187119549 X:16391239-16391261 TTTTTGTAAGAGATGTTACAAGG + Intergenic
1187124640 X:16443609-16443631 CCTTAGTTAGAAATGCTCCATGG + Intergenic
1188422321 X:30005172-30005194 ACTTTGTCAGAGATGCATCATGG + Intergenic
1189141590 X:38612641-38612663 ACTTTGTGAGAAAGGGTACAAGG + Intronic
1189403944 X:40700612-40700634 AGTTTGTTAGAGTTGCTATAAGG + Intronic
1191634790 X:63363751-63363773 ACAATGTTAGAGATGATACTGGG + Intergenic
1194182914 X:90735563-90735585 ACTATGTTCGAGATGGTTCAAGG + Intergenic
1194760589 X:97791784-97791806 AGTTTGCTAGAGATTCTACTGGG + Intergenic
1197586465 X:128353861-128353883 AACTTGTTAGAGTTGCTGCATGG + Intergenic
1198376120 X:136041724-136041746 ACTTTGTTACAGCTGCTCTAGGG - Intronic
1200343052 X:155419813-155419835 ACTTTGCTTGAGATGCATCATGG + Intergenic
1200529532 Y:4317518-4317540 ACTATGTTCGAGATGGTTCAAGG + Intergenic