ID: 1138240366

View in Genome Browser
Species Human (GRCh38)
Location 16:55422766-55422788
Sequence AATAATGCTGATAGAGTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 326}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138240366_1138240370 27 Left 1138240366 16:55422766-55422788 CCAATAACTCTATCAGCATTATT 0: 1
1: 0
2: 3
3: 23
4: 326
Right 1138240370 16:55422816-55422838 GAAGTTAGTGGACTTGTCAAAGG 0: 1
1: 0
2: 0
3: 24
4: 264
1138240366_1138240369 15 Left 1138240366 16:55422766-55422788 CCAATAACTCTATCAGCATTATT 0: 1
1: 0
2: 3
3: 23
4: 326
Right 1138240369 16:55422804-55422826 CTAAGACTCAGAGAAGTTAGTGG 0: 1
1: 0
2: 6
3: 71
4: 375
1138240366_1138240368 -10 Left 1138240366 16:55422766-55422788 CCAATAACTCTATCAGCATTATT 0: 1
1: 0
2: 3
3: 23
4: 326
Right 1138240368 16:55422779-55422801 CAGCATTATTTTACAGATGGAGG 0: 1
1: 0
2: 3
3: 36
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138240366 Original CRISPR AATAATGCTGATAGAGTTAT TGG (reversed) Intronic
901350077 1:8587507-8587529 CAGAATGCTGTTAGAGTTAGTGG - Intronic
901360304 1:8692825-8692847 CATAATTCTGGTAGAGTGATAGG - Intronic
904890439 1:33775604-33775626 AAGAATGCAGAAAGAGGTATAGG + Intronic
906394729 1:45452197-45452219 AATATTACTGATAAAGTAATGGG - Intronic
906760568 1:48373410-48373432 AAAAATTCTGATAGCGATATGGG - Intronic
907998508 1:59657141-59657163 AATAATACTGATAATGTAATGGG - Intronic
908509980 1:64843805-64843827 AATAATGCATATAGAGTGACAGG - Intronic
909133962 1:71773534-71773556 AAAAAAGCTAATAGAATTATCGG + Intronic
910030180 1:82710716-82710738 AATAATAATGATAAAGTTAAGGG - Intergenic
910599826 1:89019163-89019185 AATAATGCTGATAGGATCATGGG - Intronic
911925999 1:103833624-103833646 AATAATGCTTAAGGAGTTTTGGG - Intergenic
912725331 1:112054237-112054259 AAAAATGCTGAAGGAGTGATCGG + Intergenic
912781624 1:112554671-112554693 AATAATGCTGCTACAAATATTGG - Intronic
913154593 1:116082915-116082937 AATAATGCTGCTATAAATATGGG + Intergenic
916887526 1:169084637-169084659 TTTAATGCTTATAGAGTCATAGG - Intergenic
917337928 1:173944353-173944375 AATAATACTGATAGTCTTTTTGG + Intronic
920026072 1:202998037-202998059 AATAATGCTGCTATAAATATGGG - Intergenic
920908203 1:210190694-210190716 AATTATGCTGATATAGGTAATGG - Intergenic
923264752 1:232303766-232303788 GATAATGCAGATAAAGTTCTTGG + Intergenic
1063455694 10:6181322-6181344 AATAATGCTGATATAAACATGGG - Intronic
1063805373 10:9633276-9633298 AATACTGCTGAAAGAGAAATAGG + Intergenic
1066275245 10:33862400-33862422 AATAACACTGATGGAGCTATCGG + Intergenic
1067075928 10:43182158-43182180 AACAATTCTGATAGAGTGATGGG - Intronic
1067191218 10:44069725-44069747 AATAATGCTGCTACGGTCATGGG - Intergenic
1067254787 10:44626359-44626381 AATAAAGTAGATAGAGTAATTGG + Intergenic
1068199213 10:53761328-53761350 GATATTGCTGATAGGGTTCTAGG + Intergenic
1068268935 10:54694513-54694535 AACAATGCCGATAGATTTGTTGG - Intronic
1070462219 10:76681663-76681685 AATAATCCTGATTGATATATGGG - Intergenic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073836883 10:107454310-107454332 AATACAGCTGACAGATTTATAGG + Intergenic
1074032363 10:109701614-109701636 AAAAATGCTTATAGATTTATGGG - Intergenic
1074175486 10:110996879-110996901 AATCATGATGATAGAGGTATTGG + Intronic
1074409003 10:113208050-113208072 AAATATGCTGATAGTATTATGGG - Intergenic
1074623913 10:115156764-115156786 AGTAATGCAGAGAGAGTTATGGG + Intronic
1076170356 10:128314252-128314274 ATTAATTGTGATAGAGTAATGGG + Intergenic
1077736923 11:4801083-4801105 CAAAATGCTGATAGAAATATGGG - Intronic
1078137945 11:8667855-8667877 AATAATGCTGCTAGAAACATGGG + Intronic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1079410554 11:20183492-20183514 GATGATGCTGATATAGTTAAGGG - Intergenic
1079717459 11:23766298-23766320 AAAAATGATGATTGAGTTACTGG + Intergenic
1079758631 11:24299621-24299643 AATAATTCTGATAGATATATTGG + Intergenic
1080037051 11:27721012-27721034 AATAATGCTGTTAGAGGTTGGGG - Intronic
1080156536 11:29118029-29118051 AATATTGCTTACAGAGTGATGGG + Intergenic
1081001254 11:37675417-37675439 GACAATGCAGATAGACTTATAGG - Intergenic
1081053902 11:38384324-38384346 AATAATGCTGATATATTATTAGG - Intergenic
1084812697 11:71624375-71624397 AATAATGCTGCTATGATTATCGG - Intergenic
1085245417 11:75097096-75097118 AATACTGGTGATAAAGTTCTGGG - Intergenic
1085863935 11:80266043-80266065 TATAATGATGATAGAGATAATGG + Intergenic
1086220702 11:84439292-84439314 AATAATGATCATAGACTCATAGG - Intronic
1086288997 11:85283726-85283748 AATAATGCTACTAAAGATATAGG + Intronic
1086464814 11:87042201-87042223 AATAATGGTAATAGACTGATTGG + Intronic
1086613729 11:88789051-88789073 AATAATGTTAATATAGTTACAGG + Intronic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087205136 11:95386511-95386533 AATATTCCTGATACAATTATTGG + Intergenic
1087685117 11:101253684-101253706 AATAAAGCTGAATGAGTTTTTGG - Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088158582 11:106840173-106840195 AAAAATGATGATATTGTTATTGG + Intronic
1088479309 11:110279586-110279608 AAGAATGTTGGTAGAGTTGTTGG - Intronic
1089049255 11:115532002-115532024 AATAATGTTGTTAGAGTTATAGG - Intergenic
1090147772 11:124344847-124344869 AATGATGCTGATAGACTTGCTGG - Intergenic
1090506603 11:127321514-127321536 TAAAATGCTGATAGTGTTATGGG - Intergenic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1096397512 12:51277565-51277587 AATTATGGTGATAGTTTTATGGG - Intergenic
1096415856 12:51412118-51412140 AATAATTTTGATAGAGTGAAAGG - Intronic
1097343751 12:58468239-58468261 AAAAATGGTGATAGTGATATGGG - Intergenic
1097347663 12:58512388-58512410 AATAAAGCTGATAAAACTATAGG - Intergenic
1097361525 12:58663868-58663890 AAGAATTCTGAAAGAGTTCTTGG - Intronic
1098078667 12:66760147-66760169 AAAAATGCTGATAGTGTGCTGGG - Intronic
1098474261 12:70882042-70882064 AAGATTGGTAATAGAGTTATCGG - Intronic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1100024257 12:90108586-90108608 AATAATGCTGATAGTTTAAATGG + Intergenic
1100489425 12:95064542-95064564 AATAATGCTGATAGACTGAAGGG + Intronic
1100555171 12:95686191-95686213 GATAATTCTTATAGAGATATAGG + Intronic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101484201 12:105135625-105135647 AATAATGCTCGAAGAGTTAATGG - Intronic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1105293374 13:19068721-19068743 AACAATGCTATTAGAGTTCTTGG - Intergenic
1105452739 13:20514928-20514950 AATAATGCTGCTATAATCATTGG - Intronic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1106636882 13:31538541-31538563 ATAAATGCTGAGTGAGTTATTGG - Intergenic
1106673449 13:31932124-31932146 AACAACGCTGTTAGAGTTGTGGG - Intergenic
1106992044 13:35431604-35431626 TCTAATGCTAATAGAGTTCTTGG - Intronic
1107759827 13:43666165-43666187 AATGATGCTGATAGACTTGCTGG + Intronic
1109887697 13:68563816-68563838 AATAATTTTGATAGAGTGTTTGG + Intergenic
1110164525 13:72423600-72423622 AATAATACTTATATAGTAATGGG - Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114507520 14:23229328-23229350 AATAATGCTGGTAGGAATATTGG + Intronic
1115012168 14:28562123-28562145 AATAATTCTGATATTGCTATAGG + Intergenic
1115580254 14:34750953-34750975 AATAATGCTGATTGCTTTCTTGG + Intergenic
1116248293 14:42446835-42446857 AAAAATGATGATAAAGTCATTGG - Intergenic
1116913663 14:50499274-50499296 AAGAATGCTGGTAGAGTTAAGGG + Intronic
1117218113 14:53573044-53573066 TATATTGCTGAACGAGTTATGGG - Intergenic
1118988675 14:70778609-70778631 AATGATGATGACAGTGTTATAGG - Intronic
1120072723 14:80122036-80122058 CAAAATGCTGATAGAAATATGGG + Intergenic
1120404389 14:84076479-84076501 AATATTTCTGAAAGAATTATCGG - Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1121084713 14:91137080-91137102 TCTAATGCTCATAGAGTGATGGG + Intronic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123868097 15:24542512-24542534 AAAATTGCTGATGAAGTTATAGG + Intergenic
1123912259 15:24979434-24979456 CATAATACTGATAGACTGATTGG + Intergenic
1124865289 15:33484674-33484696 AAGTATGATGCTAGAGTTATAGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1127643800 15:60940094-60940116 AAAAATGCTGATAGGGTTGGAGG - Intronic
1130574585 15:85080636-85080658 AACTATGCTGATAGACTTCTTGG - Intronic
1131410101 15:92200401-92200423 CAAAATGCTGATAGAAATATGGG + Intergenic
1137880411 16:52040025-52040047 AATAATGCTGTTATAAATATTGG + Intronic
1138240366 16:55422766-55422788 AATAATGCTGATAGAGTTATTGG - Intronic
1138871776 16:60897395-60897417 AATTCTGCTGATATATTTATTGG + Intergenic
1139619887 16:68130094-68130116 AATAATGCTGAAAGAAACATAGG + Intronic
1140940244 16:79714921-79714943 AATAATGTTCATAGAGCAATTGG + Intergenic
1142961027 17:3552759-3552781 AAAAATGAGGATAGAGTTTTGGG - Intronic
1144191951 17:12854509-12854531 AAGAATGATGATACAGTTAGTGG + Intronic
1146548046 17:33756078-33756100 GATCATGCTGATAGAGTATTGGG - Intronic
1147942334 17:44057911-44057933 ACTAATGCTCATTGAATTATGGG - Intronic
1149062410 17:52438427-52438449 AATTTTGCTGAAAGAGATATGGG - Intergenic
1149545000 17:57496786-57496808 AGAAATGCTGTTAGATTTATAGG + Intronic
1149671917 17:58421550-58421572 ATAAATGCTGATAGATTTAAAGG - Exonic
1153859829 18:9191200-9191222 AATAAACCTAACAGAGTTATGGG + Intronic
1153867140 18:9281038-9281060 GTAAATGCTGATAGATTTATAGG - Exonic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156711727 18:39955721-39955743 AATTATGCTGGTAGACTTGTTGG + Intergenic
1158754219 18:60302709-60302731 TATAATGCTGATAGTGTTGATGG + Intergenic
1160358945 18:78253852-78253874 AATAAAGCTGAGACAATTATTGG - Intergenic
1164223328 19:23217614-23217636 AATAATGCTAATTCATTTATAGG - Intergenic
1164568243 19:29347623-29347645 AATAATGCTGCTATAGGCATGGG - Intergenic
1165509711 19:36258913-36258935 AATTATGCTGAAAGAGGTTTGGG - Intergenic
927729856 2:25461616-25461638 AGTAATGCTGTTAGAACTATTGG - Intronic
927788199 2:25988921-25988943 AATAATTCTGGTAGAGTCAGGGG - Intergenic
927795059 2:26040807-26040829 AATAATTTTTATAGATTTATAGG + Intronic
928970270 2:37021030-37021052 AGTAATGCTGATGATGTTATAGG + Intronic
929536132 2:42785262-42785284 AGTAATGCTAATATAATTATAGG + Intronic
930395788 2:50822785-50822807 AATAATAATAATAGAGTTAAGGG + Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
931769035 2:65481589-65481611 AATCATGCTGTTAGAGTTTATGG - Intergenic
932507660 2:72251899-72251921 AAGAGTGCTGATAGATTTGTTGG - Intronic
933124268 2:78584651-78584673 AGTAAAGCTGATACATTTATAGG + Intergenic
934026766 2:88007388-88007410 AATAATACTGATTAGGTTATAGG - Intergenic
934081939 2:88476157-88476179 AATAATGCAGAAAGAGTTGTAGG + Intergenic
934129219 2:88931461-88931483 AATAAGGCTGTTACAGTGATGGG + Intergenic
936268248 2:111027868-111027890 AATAAAGCTGTTAGAGAAATAGG - Intronic
936776449 2:115979787-115979809 AATGATGCTGATATTTTTATGGG + Intergenic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937569897 2:123343952-123343974 AATAATGCTGATATGAATATGGG + Intergenic
938719812 2:134056542-134056564 AATAATGCAGAGAGAGTTCTCGG - Intergenic
939835902 2:147129472-147129494 AATAATGATGATACAATTAGTGG - Intergenic
940065128 2:149619035-149619057 AATCCTGTTGAGAGAGTTATTGG - Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
941449382 2:165641431-165641453 AATAATCCTGGGAGAGTTAAAGG - Intronic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
945643228 2:212457577-212457599 AATTATGCCAATAGAGTGATAGG - Intronic
945665725 2:212739455-212739477 ATTAATGGTGATAGAATAATTGG + Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
1169189151 20:3646233-3646255 ACTAATGCTGACTGAGTGATAGG + Intronic
1169585125 20:7073445-7073467 AATAATGCTGCTATAAATATTGG + Intergenic
1169858170 20:10125591-10125613 AATAATGATGATACATTTATTGG - Intergenic
1170125342 20:12956946-12956968 TATAATGCTGATAGACTAAGTGG + Intergenic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1171877969 20:30596101-30596123 AACAATGCTATTAGAGTTCTTGG - Intergenic
1177285731 21:19047126-19047148 AATAATGATAATAGAGCCATTGG - Intergenic
1177321840 21:19531966-19531988 GATAATGCAGGTAGAGTTTTAGG - Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177722885 21:24929659-24929681 AATAATTCTGCTATAGTAATAGG - Intergenic
1177990692 21:28032449-28032471 AATAATACTCATAGACTTAAAGG + Intergenic
1178107852 21:29340332-29340354 AATAATTCTGGTGGAGTTCTAGG + Intronic
1179993624 21:44962125-44962147 AATAATTCTGCTAGAGTTCATGG + Intronic
949723148 3:7014021-7014043 ATTAATTCTGATAGATTTTTTGG + Intronic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951847085 3:27096228-27096250 TATAATGTTGATGGAGTTACTGG - Intergenic
952017555 3:28976229-28976251 AATTATGATAATAGACTTATGGG - Intergenic
954829152 3:53403827-53403849 AATAGTGCTGAAAGAGTATTTGG + Intergenic
955381896 3:58445589-58445611 AATAATGCTGCTATAAATATTGG + Intergenic
955456891 3:59131759-59131781 GATAATGCTCATAGATTTGTTGG + Intergenic
955885559 3:63594741-63594763 GATAATGATGATAGTGTTAATGG - Intronic
956018106 3:64905645-64905667 TATAATGCTGAAACAGTTAAGGG + Intergenic
956571353 3:70699662-70699684 AGTAATGCAGATAGAGTTGCAGG - Intergenic
957097653 3:75791863-75791885 AATAATGCTGAAATAAATATGGG - Intergenic
957946837 3:87074864-87074886 AATAATAATTATAGATTTATGGG - Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
959124169 3:102270245-102270267 TATAATGCTGATAATGTTATTGG + Intronic
959195572 3:103176225-103176247 AATAATGCTGATATAAACATGGG + Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959506596 3:107163429-107163451 AGTATTGCTGAAAGAGGTATAGG + Intergenic
960247849 3:115419228-115419250 AAGAATGCTGATGGGGTTTTGGG - Intergenic
960631896 3:119740816-119740838 ACAAATGCTGACAGAGTGATGGG - Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963339026 3:144012001-144012023 AATACTGTTGATACAGTTGTGGG + Intronic
964060213 3:152512887-152512909 AATAATTCTGATTTACTTATGGG - Intergenic
964838382 3:160966600-160966622 AATAATGCTGCAAGAAATATGGG + Intronic
965232713 3:166073438-166073460 AAAAATGCTGATAGAAATATGGG - Intergenic
966064874 3:175807635-175807657 TATATTGCTGATATATTTATTGG - Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
966954680 3:184863408-184863430 AATAAGCCTGATAGATTTAAGGG + Intronic
967143881 3:186589378-186589400 AATAATGCCGTGAGAGCTATCGG + Intronic
967349646 3:188498601-188498623 AATAATGCTGCTATAAGTATGGG + Intronic
967390894 3:188953128-188953150 AATAGTTCTGGTAGAGATATAGG + Intronic
968325611 3:197812449-197812471 AATAATGCTGATGTAAATATTGG + Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
972930084 4:44061941-44061963 TATAATTTTGATAGAATTATTGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974260077 4:59516423-59516445 AATTAAGCTGTTAGACTTATAGG - Intergenic
974597077 4:64028504-64028526 AATTCTGCTGCTAGAGGTATTGG + Intergenic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
975055101 4:69920286-69920308 AATAATGCTGATAAAAGGATGGG + Intergenic
976034844 4:80804566-80804588 AATAATGCTGCTATAAATATGGG + Intronic
976814432 4:89131096-89131118 ATTATTCCTGATAGAGTTAGTGG + Intergenic
977021653 4:91767720-91767742 AATAATGCTGAAATAATCATGGG + Intergenic
977247046 4:94644846-94644868 AATAATACTAATAAAGTTCTTGG - Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
978223825 4:106309845-106309867 AATAATCCTGACAGAGCTATTGG + Intronic
978741075 4:112138612-112138634 CATTATGGTGATAGATTTATGGG + Intergenic
979008128 4:115330705-115330727 AATACTGCTGACATAGTCATTGG + Intergenic
979112928 4:116781715-116781737 GATGATGGTGATAGAGTCATAGG - Intergenic
980282909 4:130743388-130743410 AATGATGTTGATAGTGTGATAGG + Intergenic
980743908 4:136990375-136990397 AATAATGCTGAAATAAATATTGG - Intergenic
980935687 4:139223255-139223277 AAGAATGCTGACAGATTTATGGG + Intergenic
981048031 4:140283442-140283464 AAAAATGCTTGTAGTGTTATAGG - Intronic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
982210281 4:153029194-153029216 CAAAATGCTGATAGAAATATGGG - Intergenic
983420067 4:167506199-167506221 AATAATGTTCATTGAGCTATAGG - Intergenic
983649545 4:170025071-170025093 AATAATCCTAATAGTGTTAATGG + Intronic
983695701 4:170527267-170527289 GATAATGCTGATAGTTTTATGGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
983976203 4:173937122-173937144 AAAAATGATGAAAGAGTTATGGG - Intergenic
985078208 4:186238882-186238904 AGTGATACTGTTAGAGTTATAGG + Intronic
985078211 4:186238953-186238975 AGTGATACTGTTAGAGTTATAGG + Intronic
985078214 4:186239024-186239046 AGTGATACTGTTAGAGTTATAGG + Intronic
985078219 4:186239143-186239165 AGTGATACTGTTAGAGTTATAGG + Intronic
985078222 4:186239215-186239237 AGTGATACTGTTAGAGTTATAGG + Intronic
985078227 4:186239358-186239380 AGTGATACTGTTAGAGTTATAGG + Intronic
985078230 4:186239430-186239452 AGTGATACTGTTAGAGTTATAGG + Intronic
985078235 4:186239549-186239571 AGTGATACTGTTAGAGTTATAGG + Intronic
985078238 4:186239621-186239643 AGTGATACTGTTAGAGTTATAGG + Intronic
985078243 4:186239751-186239773 AGTGATACTGTTAGAGTTATAGG + Intronic
985078252 4:186239953-186239975 AGTGATACTGTTAGAGTTATAGG + Intronic
985078257 4:186240083-186240105 AGTGATACTGTTAGAGTTATAGG + Intronic
988009510 5:25464379-25464401 CATAATGCTGATAGTAATATGGG + Intergenic
988213896 5:28246435-28246457 AATAATGCTGTTATAAATATTGG - Intergenic
989088103 5:37697330-37697352 TATTATGCTTATAAAGTTATTGG - Intronic
989444879 5:41515775-41515797 AATAATGCTTCTAGAAGTATTGG - Intergenic
989792135 5:45418460-45418482 AATAATGCTGATAGCATTAATGG + Intronic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
990712457 5:58600376-58600398 AATAATGGTGATATTTTTATGGG + Intronic
990803380 5:59631130-59631152 CATAATGCAAATAAAGTTATTGG - Intronic
991232233 5:64347545-64347567 AAAAATGCAGCTACAGTTATGGG - Intronic
992791190 5:80215631-80215653 AATACTGCTGCCACAGTTATGGG - Intronic
993133986 5:83933710-83933732 AATAATGATGGTAGAATTTTAGG - Intergenic
993216512 5:85030124-85030146 AATAAGTTTGATAGAGTTTTTGG - Intergenic
993642291 5:90419894-90419916 AATAATGCTGCTACAAATATGGG - Intergenic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
995504108 5:112841079-112841101 AATAATGAAGATAGAGTCAGAGG + Exonic
997091842 5:130867331-130867353 AATAGTGGGGATACAGTTATAGG - Intergenic
998604548 5:143620152-143620174 AATAATTTTGATAAAGTCATTGG - Intergenic
998706634 5:144769648-144769670 CATAATGCTGATAAAGTAGTTGG + Intergenic
998724428 5:144994215-144994237 AATAATATTGATAAACTTATAGG - Intergenic
999039700 5:148393827-148393849 AATAATGTTGGTACAGATATAGG - Intronic
1000772311 5:165370589-165370611 AAAAATGATGGTAGAATTATTGG - Intergenic
1000988268 5:167884697-167884719 AATAATGCTGCTAGGAATATTGG + Intronic
1003804287 6:9708471-9708493 AATAATGCTGTTATAATCATGGG - Intronic
1004324043 6:14657468-14657490 CACAATGCTGATAGGGCTATTGG - Intergenic
1006666346 6:35697131-35697153 AATAATGCTGATATATACATTGG - Intronic
1006962165 6:37944261-37944283 AATGATGCAGATAGTGTTTTTGG - Intronic
1008454446 6:51692841-51692863 AATAGTGTTGACAGAGTGATTGG - Intronic
1008887072 6:56443107-56443129 AATAATGCTGATATAAACATGGG - Intergenic
1009625859 6:66138370-66138392 CATAATGGGGATAGAGTTATGGG - Intergenic
1010144402 6:72650068-72650090 AATTATGTTTATATAGTTATTGG + Intronic
1010250416 6:73701249-73701271 AATGATGCTGATAGTGGTAGAGG - Intronic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1010819481 6:80396328-80396350 TATAATGAGGATAGAGGTATTGG - Intergenic
1011055385 6:83198407-83198429 ACTAATGCAGATAGTATTATGGG + Exonic
1011135098 6:84091691-84091713 AAAAATGATGATATAGTCATGGG - Intergenic
1011754996 6:90489353-90489375 AATAATGCTGCTATAAATATGGG + Intergenic
1012514838 6:100047450-100047472 AATAATGCTGAAAGAGAGTTTGG - Intergenic
1013739789 6:113268728-113268750 AAGAGTGCTGATAGACTTCTTGG - Intergenic
1017679881 6:156852973-156852995 TATAATGCTGATAGGGATAATGG + Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020310417 7:6863303-6863325 AATAATGCTGCTATGGATATGGG + Intergenic
1020386932 7:7616801-7616823 AATAATGCTGCTATAAATATTGG - Intergenic
1021443377 7:20705560-20705582 AAAAATTCTAGTAGAGTTATAGG + Intronic
1024611782 7:51071637-51071659 GATACTGCTCATAGAATTATTGG - Intronic
1026490362 7:70857708-70857730 CACAAGGCTGATTGAGTTATCGG + Intergenic
1027625553 7:80539944-80539966 AATGCTGATGATAGAGTTTTGGG + Intronic
1027732665 7:81895923-81895945 AATGATGTTGATATATTTATAGG + Intergenic
1027741073 7:82006012-82006034 AATGATGATGATAAAGTTGTGGG - Intronic
1027801525 7:82757250-82757272 AATAATGCTGATAGAGAAGAGGG + Exonic
1027957397 7:84898591-84898613 AATAATGCTGCATGAGTTTTAGG + Intergenic
1028102182 7:86834025-86834047 AATAATGCTGCTACAAATATTGG - Intronic
1031094077 7:117398286-117398308 TATAATTGTGATAGTGTTATGGG - Intronic
1031229327 7:119085068-119085090 AATAAGGCTGAGAGCATTATGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031756570 7:125651274-125651296 AATAATGCTGCTATAAATATGGG - Intergenic
1032837772 7:135689858-135689880 AATAATGCAGATAGTATTTTGGG + Intronic
1032981840 7:137292976-137292998 AAAAATTCTGATAGAGTGTTAGG - Intronic
1033653525 7:143359269-143359291 AATAATGCTGACAGACTCCTTGG - Intronic
1037125426 8:15342259-15342281 AATTATCCTGATGGAGTTAGAGG - Intergenic
1038318927 8:26511293-26511315 AGCACTGCTGATAGAGTTACAGG - Intronic
1038657164 8:29463682-29463704 AATAATGATGGTAAAATTATAGG - Intergenic
1039046588 8:33456055-33456077 AAAAATGCTGAGAGAGCTATTGG - Intronic
1039083453 8:33756610-33756632 AATAATGCAGGTAAAGTTCTTGG - Intergenic
1040547610 8:48411421-48411443 AAAAATGCTGAAAGAGCTAAAGG + Intergenic
1040695254 8:49988939-49988961 AATACAACTGAAAGAGTTATTGG + Intronic
1040854142 8:51931648-51931670 AATAGCCCTGAAAGAGTTATAGG + Intergenic
1040947255 8:52896097-52896119 AATGATGGTGTTAAAGTTATGGG - Intergenic
1043243867 8:77973567-77973589 AAGTATGCTTATAGAATTATTGG + Intergenic
1043341327 8:79243464-79243486 AATAATGCAGATAGCCTTGTGGG - Intergenic
1043535390 8:81198095-81198117 AATAATGCTTATAGAAGCATTGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044307898 8:90658638-90658660 AATATTCCTGATAGAGTTGATGG + Intronic
1046227767 8:111307519-111307541 AATAATGGTGATAAAATAATTGG - Intergenic
1046466100 8:114605130-114605152 AACAATTTTGATAGACTTATAGG - Intergenic
1046577474 8:116048689-116048711 AATAATGCTGATAAAGTCCAGGG - Intergenic
1046600332 8:116309213-116309235 AATCATGCGGATATAGCTATAGG - Intergenic
1047609975 8:126511453-126511475 AATAATGCGGGTAAAGTTCTTGG - Intergenic
1048030690 8:130628785-130628807 ATAAATGCTGCTAAAGTTATTGG + Intergenic
1048483389 8:134823677-134823699 ATTAAAGCTGATAGACTTAAAGG - Intergenic
1048556770 8:135485693-135485715 AATAATGATGATAAAGATAAGGG + Intronic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1050798148 9:9572493-9572515 AATAATGCTGATTTATTAATTGG + Intronic
1050890625 9:10819845-10819867 AAAAATGCTGAGAGTGATATGGG - Intergenic
1051671929 9:19519470-19519492 AATATTCCTGGTAGAGTTCTTGG - Intronic
1052218266 9:25992048-25992070 AAGAATGTTTATAGATTTATTGG - Intergenic
1052364435 9:27596155-27596177 AAAAATACTGATACTGTTATGGG - Intergenic
1052822497 9:33148817-33148839 AAAAATGCTCAAAGAGTAATAGG + Intronic
1052876644 9:33573092-33573114 AAAAGTGCTGACAGAGTAATGGG - Intergenic
1057251068 9:93502480-93502502 AATATTGCAGATAGATTTACAGG - Intronic
1057405397 9:94765757-94765779 AATAATAATGATAAAATTATTGG - Intronic
1058127692 9:101214608-101214630 AATAATGCTGATAGAATTAAAGG - Intronic
1059228389 9:112694414-112694436 AATTATGCTGTTAAAGTTACTGG - Intronic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059631888 9:116133889-116133911 AATAATGCTGTTATAAATATGGG - Intergenic
1061742864 9:132719998-132720020 AATAATGCTGCAAGAGACATCGG - Intergenic
1185919677 X:4077084-4077106 AATGATTCTGAAATAGTTATTGG + Intergenic
1187639228 X:21269602-21269624 AATAATGCTGATATTTTGATAGG + Intergenic
1187671641 X:21672451-21672473 TTTAATGTTCATAGAGTTATAGG + Intergenic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192676821 X:73205507-73205529 AATAATGCTGCTACAATCATGGG - Intergenic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1194816163 X:98444560-98444582 ACTAATGGTGATAGAATAATTGG + Intergenic
1195284721 X:103372914-103372936 AACACTGCTGATACAGCTATTGG - Intergenic
1195490067 X:105457762-105457784 AATAATGCTGCTATAGACATTGG + Intronic
1197660449 X:129165425-129165447 GATAATGATGATAAAGTTATAGG + Intergenic
1198569189 X:137937314-137937336 CAAAATGCTGATAGAAATATGGG + Intergenic
1198588470 X:138149197-138149219 CAAAATGCTGATAGAAATATGGG + Intergenic