ID: 1138241125

View in Genome Browser
Species Human (GRCh38)
Location 16:55427945-55427967
Sequence CCTAAACAGAAGTGGGTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138241114_1138241125 23 Left 1138241114 16:55427899-55427921 CCTTGAGCCAGGAAGACTATGCA 0: 1
1: 0
2: 1
3: 12
4: 167
Right 1138241125 16:55427945-55427967 CCTAAACAGAAGTGGGTCAAAGG 0: 1
1: 0
2: 1
3: 8
4: 143
1138241116_1138241125 16 Left 1138241116 16:55427906-55427928 CCAGGAAGACTATGCACAGGCTC 0: 1
1: 0
2: 0
3: 5
4: 129
Right 1138241125 16:55427945-55427967 CCTAAACAGAAGTGGGTCAAAGG 0: 1
1: 0
2: 1
3: 8
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138241125 Original CRISPR CCTAAACAGAAGTGGGTCAA AGG Intronic
904631782 1:31848161-31848183 CCGAGACAGAAGTGGGGCCAGGG + Intergenic
908310154 1:62873243-62873265 TCTAAACAGAAGTGGGTTTGGGG + Intergenic
908607912 1:65820648-65820670 CCTTAATAGCAGTGAGTCAATGG + Intronic
910208209 1:84768527-84768549 CCTCAACAGAAGTTGGTTATTGG - Intergenic
910373463 1:86543355-86543377 CCTAAACAGAAGCTTGTCCAAGG - Intergenic
911253829 1:95611198-95611220 ACCAAAGAGAAGTGGGTGAAGGG - Intergenic
913390567 1:118306828-118306850 GCAAAACAGAACTTGGTCAAAGG + Intergenic
915490975 1:156249920-156249942 ACAAAGCAGAAGTGGGGCAATGG + Exonic
917343951 1:174009296-174009318 CCTATACAGAAGTGGGGAGAAGG - Intronic
918780613 1:188695207-188695229 ACTAAAGAGAAGTAGGTTAAAGG - Intergenic
919368786 1:196699886-196699908 GCTATAAGGAAGTGGGTCAATGG - Intronic
919416219 1:197313577-197313599 TATAAAGAGAAGTTGGTCAATGG - Intronic
920650220 1:207832040-207832062 CATAAACACAAGTGGGGCAGGGG + Intergenic
922924802 1:229339668-229339690 CCCAGACAGAAGTAGGTCAGGGG + Intronic
923272284 1:232367623-232367645 CCTAAACAGCAAAGGGTCAAAGG - Intergenic
923471174 1:234292350-234292372 ACTAGGCATAAGTGGGTCAAGGG - Intronic
923638846 1:235730719-235730741 CCTAAACAGGAAAGGCTCAAGGG - Intronic
1071456865 10:85857636-85857658 CCTCAGCCAAAGTGGGTCAAGGG + Intronic
1078320346 11:10328874-10328896 ACTTCACAAAAGTGGGTCAAGGG + Intronic
1079570061 11:21931976-21931998 CGCAAACAGAAGTGAGTTAAGGG - Intergenic
1080988335 11:37498991-37499013 CCTAAACAGAAGTGGAAGAGAGG + Intergenic
1084265910 11:68005002-68005024 CCTAAAGAGCAGTGGGTGGAGGG - Intergenic
1085505523 11:77056566-77056588 TCTACACAGAAGTGGGGAAAAGG + Intergenic
1087142198 11:94775857-94775879 CCAAAACAGAAGTGGTAAAATGG - Intronic
1088719165 11:112576620-112576642 CCCAACCAGAAATGGGGCAAAGG - Intergenic
1089087769 11:115837738-115837760 CCTAAACTGAAGTTTGTCATTGG - Intergenic
1090648310 11:128784320-128784342 CCTAAACACAAAAGGGCCAAGGG - Intronic
1092623563 12:10301174-10301196 GCTACACAGAAATGAGTCAAAGG - Intergenic
1094204843 12:27829389-27829411 CCTAAAGCGAAGTGGGTGAGCGG - Intergenic
1096962794 12:55597610-55597632 CCTAAACAGAAATTTCTCAAAGG + Intergenic
1100313222 12:93416989-93417011 CCCAAACAGAAGTGAGTTTAGGG + Intronic
1101428744 12:104608931-104608953 TCAAGACAGAAGTGGCTCAAGGG - Intronic
1101605034 12:106241733-106241755 ACTAGGCAGAAGTGGGTCCAGGG - Intronic
1103197655 12:119059115-119059137 CCCAAACAGAAGTGGTTACAGGG - Intronic
1104426449 12:128682195-128682217 TCTACACAGGAGTGGGGCAAGGG + Intronic
1107521342 13:41185234-41185256 CTTAATCAGAGGTGGGCCAAAGG + Intergenic
1109420508 13:62105705-62105727 CCTAACCATAGGTGGGTCATAGG - Intergenic
1115529123 14:34310593-34310615 GCTTATCAGAAGTGGCTCAAAGG + Intronic
1115807260 14:37064908-37064930 CCTTAACAGATGTGTGTCAAAGG - Intronic
1115853576 14:37606288-37606310 CCTAAAGAGAAGTAGGCAAAGGG - Intronic
1117211958 14:53509714-53509736 CCCATTCAGGAGTGGGTCAAGGG + Intergenic
1119171794 14:72541179-72541201 CCTCAACAGAGGTGGAACAAAGG - Intronic
1119227696 14:72956593-72956615 CCAAAACAGAACTGAATCAAGGG + Intronic
1119976699 14:79032451-79032473 CATAAACAGAACTGACTCAAAGG + Intronic
1120368248 14:83598055-83598077 AATAAAGAGAAGTGGGTTAAAGG + Intergenic
1124443932 15:29711665-29711687 CAAAATCAGAAGTGGGTCTAGGG - Intronic
1125698741 15:41661239-41661261 CATAAACAGAACTAGGTAAAAGG - Intronic
1130063471 15:80586161-80586183 CTTAAAGAGAAATGGCTCAAAGG + Intronic
1133577324 16:7105633-7105655 CATAAAAAGGAATGGGTCAATGG - Intronic
1133914640 16:10098125-10098147 CCCAAACAAAAGTGGGCTAAGGG + Intronic
1134158315 16:11862733-11862755 CCTAAACATAATTGAATCAAAGG + Intergenic
1135053344 16:19210411-19210433 GATAAAGAGAAGTGGGTTAAAGG - Intronic
1135163057 16:20114541-20114563 CCATAAAAGAAGTGAGTCAATGG - Intergenic
1138241125 16:55427945-55427967 CCTAAACAGAAGTGGGTCAAAGG + Intronic
1143539455 17:7560576-7560598 CCTAAACAGAGGCGGGTCTGAGG + Intronic
1144694969 17:17297259-17297281 CCTAAATAATAATGGGTCAAAGG - Intergenic
1145774393 17:27517754-27517776 ACAATACAGAAGTGGGCCAAGGG - Intronic
1148455998 17:47811676-47811698 GCAGAACAGAAGTGGGTCAGGGG + Intronic
1150549298 17:66194278-66194300 CCTAAAGAGATCTGGTTCAATGG + Intergenic
1153925951 18:9835100-9835122 CCGAGACACAGGTGGGTCAAGGG + Intronic
1156656487 18:39294551-39294573 CCAAAACACATGTGGATCAAAGG + Intergenic
1158292677 18:55958868-55958890 TTTAAACAGAAGTGGGGAAAGGG + Intergenic
1161828738 19:6587689-6587711 CCTAGAGAGAAGAGGGCCAACGG - Intronic
1165874496 19:38996380-38996402 CTTGAGCAGAACTGGGTCAAAGG + Intronic
1167526633 19:49988360-49988382 CAAAAACAGAAGTGAGTCTAGGG - Exonic
925343681 2:3154580-3154602 CCTGAAGATAAGTGGGTCCATGG + Intergenic
926705768 2:15836360-15836382 AGGAAACAGAAGTGGGTCAGGGG + Intergenic
926871207 2:17419834-17419856 CCTCAAGAGAAGAGGGTAAAAGG - Intergenic
928674987 2:33641874-33641896 CAAACACAGAAGTGGGTCATGGG - Intergenic
928817332 2:35314519-35314541 CTTAAAGAGAACTGGGTCACTGG - Intergenic
929423390 2:41818414-41818436 CCAAAACAGATCTTGGTCAAAGG + Intergenic
930534043 2:52625123-52625145 CCTCAACCTAACTGGGTCAACGG + Intergenic
930548178 2:52796830-52796852 ACTAAACATGAGTGGGACAAAGG - Intergenic
930811682 2:55548205-55548227 TCTAAACAAATGCGGGTCAATGG - Intronic
931095657 2:58937837-58937859 CCTAAACAAAAATGGGACACTGG - Intergenic
932104718 2:68932164-68932186 CCTAAAGGGAAGTCTGTCAATGG - Intergenic
933135427 2:78728153-78728175 CATAAAAAGAGGTGGGTTAATGG + Intergenic
933685252 2:85136234-85136256 CCTAAAGAGAAATGGGTGCATGG - Intronic
935280845 2:101516521-101516543 CTTATAAGGAAGTGGGTCAAAGG - Intergenic
935611216 2:105027590-105027612 GCCACACAGAAGTGGGTCAGTGG - Intergenic
937642646 2:124230857-124230879 GCTATACAGAAATGGGTCAGTGG + Intronic
939950911 2:148470912-148470934 GCTGAACAGAAGTAGGTGAATGG + Intronic
941297043 2:163752199-163752221 AATAAACAGAAATGCGTCAAGGG + Intergenic
941890449 2:170575616-170575638 CCTAAACAGATATGGGCCAATGG + Intronic
946961413 2:224989510-224989532 CCTAAACAAAAGTGACCCAAAGG + Intronic
948437025 2:237960821-237960843 CCTAAACTCATGTGGGTCAGTGG + Intergenic
1170969476 20:21104038-21104060 CCTAGACAGAAGTGAGTCCTTGG - Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1180607009 22:17066436-17066458 CCTAAAAAAAAGTGTGTGAAAGG + Intergenic
1180957406 22:19747174-19747196 CATGAACAGAAATGGGTCAGGGG - Intergenic
1182877119 22:33701790-33701812 CCTAAGCAGAAAAGGGACAATGG + Intronic
1184742780 22:46438709-46438731 GCTGAAGAGAAGTGGGTTAAGGG + Intronic
951165138 3:19476535-19476557 CCTAATCAGAAGCGGGTCACTGG + Intronic
952934591 3:38386290-38386312 GGCAAACAGAAGTGGCTCAAGGG - Intronic
954879837 3:53826708-53826730 ACTAAAAAGGAGTGGTTCAAAGG - Intronic
955547986 3:60052085-60052107 CCTAAAAACAAGTGGCTCATGGG - Intronic
956885710 3:73557105-73557127 CCTGCACAGAACTTGGTCAAAGG + Intronic
958599861 3:96282484-96282506 CCAAAACACAAGAAGGTCAATGG - Intergenic
959181613 3:102987451-102987473 CTTAAACAGAAGTGGGTGAGGGG + Intergenic
966599165 3:181758135-181758157 CCCAAACAGAACTGGGTAAAGGG + Intergenic
967695912 3:192530088-192530110 GATGAACAGAAGTGGGTTAAGGG - Intronic
969094324 4:4720414-4720436 GCTCAACAAAAGTGGGTTAACGG + Intergenic
970262385 4:14241638-14241660 CATAAACTAAGGTGGGTCAAGGG - Intergenic
972285430 4:37643507-37643529 CCTAAACACACGTGGGAAAAGGG + Intronic
974438818 4:61890835-61890857 CTTAAAAAAAAGTGTGTCAATGG - Intronic
974519561 4:62965578-62965600 CCTTCACAGAAGTGAGTCCAAGG + Intergenic
974828725 4:67162800-67162822 CCTAAAAAGCAGTGTGTCAGGGG - Intergenic
980139858 4:128901700-128901722 CCTGAAAAGAAGGGGGACAAGGG - Intronic
984132733 4:175898333-175898355 CAAAAACAGAAGTAGGTCAGAGG - Intronic
984763963 4:183385302-183385324 CCTAAACAAAACTTGGGCAAAGG + Intergenic
986596906 5:9431988-9432010 CCTAAACAAAAGAGGGGAAAAGG + Intronic
994951561 5:106470203-106470225 GATGAACAGAAGTGGGTTAATGG + Intergenic
996974426 5:129413601-129413623 AGTAAAAGGAAGTGGGTCAAGGG - Intergenic
1003438685 6:6120132-6120154 GCTAAAAAGAAGTGGGTTAAAGG - Intergenic
1004604092 6:17177523-17177545 CCAAAACAGCAGTGTGTCAAAGG - Intergenic
1006777727 6:36609045-36609067 TCTCAACAGAAGTGGGTGGAAGG + Intergenic
1007138015 6:39541703-39541725 CCTAATCTGAAGAAGGTCAAGGG + Intronic
1010018844 6:71136676-71136698 CCAAAACAAAAATGGGTAAATGG + Intergenic
1010621520 6:78082496-78082518 CATAAAGAGAGGTTGGTCAATGG + Intergenic
1012044941 6:94261793-94261815 CCTGAAGAGAAGTGAGTAAATGG - Intergenic
1012628365 6:101431800-101431822 CCAACACTGAAGTGGTTCAAGGG + Intronic
1017045737 6:150345640-150345662 CCTGACCAGAAGTGGGAAAAAGG + Intergenic
1022847876 7:34229058-34229080 TATAAACAGAAGAGGGTAAAGGG + Intergenic
1027752890 7:82173664-82173686 CCAAAACAGAAGTGAATTAAAGG - Intronic
1029412394 7:100422999-100423021 CCTAAAGAAAACTGGGTGAAGGG - Intronic
1029868191 7:103658906-103658928 CATAAACAGAGGTGGGTGGAAGG - Intronic
1030158449 7:106481765-106481787 CCAACACAGAAGAGAGTCAAAGG - Intergenic
1031683504 7:124703923-124703945 GATAAAGAGAAGTGGGTAAAAGG - Intergenic
1031985113 7:128159135-128159157 CGAAATCAGAGGTGGGTCAATGG + Intergenic
1036040996 8:5081570-5081592 ATTAAACAGAAGTTTGTCAAAGG + Intergenic
1037895107 8:22646744-22646766 CCTAAACAGAAAAGGTTCACGGG + Intronic
1037972257 8:23180996-23181018 AATGAAGAGAAGTGGGTCAACGG + Intergenic
1039834937 8:41248694-41248716 CCTAATCAGAAGTGGCTTTAAGG - Intergenic
1042776742 8:72440475-72440497 CCCAGACAGAAGTAAGTCAAGGG + Intergenic
1043323044 8:79014605-79014627 CTGAAACACCAGTGGGTCAATGG - Intergenic
1044054229 8:87548445-87548467 AATGAACAGAAGTGGGTTAAAGG + Intronic
1044082487 8:87903031-87903053 CATAAACAGAACTGGGACAGTGG + Intergenic
1046470110 8:114661614-114661636 GCTACAAGGAAGTGGGTCAAAGG - Intergenic
1046883088 8:119331791-119331813 CCTAGACACAAGGGGGTCATGGG + Intergenic
1046974664 8:120260967-120260989 GATGAGCAGAAGTGGGTCAAGGG + Intronic
1048711789 8:137220303-137220325 CCTCAAGAGAAGTGGCTAAATGG + Intergenic
1049136552 8:140906679-140906701 CATAAATAGAAGTAGGTTAAGGG + Intronic
1056726776 9:89126230-89126252 CCTAAAACAAAGTGGGTTAAAGG + Intronic
1058015746 9:100030450-100030472 CCTAAAAAAGAGTGGGTTAAAGG + Intronic
1186123221 X:6384932-6384954 CATAAAGAGAAGTGGGGAAAGGG + Intergenic
1186140346 X:6565301-6565323 AATAAACAGAAGTTGGTTAATGG + Intergenic
1186615395 X:11181000-11181022 CCTTGACAGAAGTGGGTCAAAGG + Intronic
1193442836 X:81564571-81564593 CCTAAAAAGAAATGGAGCAAAGG + Intergenic
1193553915 X:82931079-82931101 TCTAAAAAGTAGTGGGGCAATGG - Intergenic
1198760851 X:140031098-140031120 GGTAAAGAGAAGTGGGTTAAAGG - Intergenic
1201276210 Y:12301121-12301143 TCTTCACAGATGTGGGTCAAAGG + Intergenic
1201986758 Y:19977017-19977039 GCTAAACTTAAGTGGGTCATGGG + Intergenic
1202056456 Y:20837544-20837566 GGTAAACAGAGGTGGGTTAATGG - Intergenic