ID: 1138241856

View in Genome Browser
Species Human (GRCh38)
Location 16:55433882-55433904
Sequence GAGGAGAAGGAAAATGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1873
Summary {0: 1, 1: 1, 2: 21, 3: 256, 4: 1594}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138241841_1138241856 29 Left 1138241841 16:55433830-55433852 CCTGCTGTCCCCCGCCTCCCCCA 0: 1
1: 1
2: 5
3: 74
4: 868
Right 1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG 0: 1
1: 1
2: 21
3: 256
4: 1594
1138241845_1138241856 18 Left 1138241845 16:55433841-55433863 CCGCCTCCCCCATGCTGACACAC 0: 1
1: 0
2: 4
3: 36
4: 465
Right 1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG 0: 1
1: 1
2: 21
3: 256
4: 1594
1138241843_1138241856 20 Left 1138241843 16:55433839-55433861 CCCCGCCTCCCCCATGCTGACAC 0: 1
1: 0
2: 3
3: 19
4: 314
Right 1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG 0: 1
1: 1
2: 21
3: 256
4: 1594
1138241851_1138241856 9 Left 1138241851 16:55433850-55433872 CCATGCTGACACACAGCAGGCTA 0: 1
1: 0
2: 2
3: 20
4: 186
Right 1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG 0: 1
1: 1
2: 21
3: 256
4: 1594
1138241840_1138241856 30 Left 1138241840 16:55433829-55433851 CCCTGCTGTCCCCCGCCTCCCCC 0: 1
1: 1
2: 7
3: 99
4: 1143
Right 1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG 0: 1
1: 1
2: 21
3: 256
4: 1594
1138241842_1138241856 21 Left 1138241842 16:55433838-55433860 CCCCCGCCTCCCCCATGCTGACA 0: 1
1: 0
2: 4
3: 32
4: 422
Right 1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG 0: 1
1: 1
2: 21
3: 256
4: 1594
1138241847_1138241856 12 Left 1138241847 16:55433847-55433869 CCCCCATGCTGACACACAGCAGG 0: 1
1: 0
2: 2
3: 23
4: 254
Right 1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG 0: 1
1: 1
2: 21
3: 256
4: 1594
1138241846_1138241856 15 Left 1138241846 16:55433844-55433866 CCTCCCCCATGCTGACACACAGC 0: 1
1: 0
2: 1
3: 42
4: 329
Right 1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG 0: 1
1: 1
2: 21
3: 256
4: 1594
1138241850_1138241856 10 Left 1138241850 16:55433849-55433871 CCCATGCTGACACACAGCAGGCT 0: 1
1: 0
2: 1
3: 23
4: 186
Right 1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG 0: 1
1: 1
2: 21
3: 256
4: 1594
1138241844_1138241856 19 Left 1138241844 16:55433840-55433862 CCCGCCTCCCCCATGCTGACACA 0: 1
1: 1
2: 4
3: 40
4: 366
Right 1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG 0: 1
1: 1
2: 21
3: 256
4: 1594
1138241849_1138241856 11 Left 1138241849 16:55433848-55433870 CCCCATGCTGACACACAGCAGGC 0: 1
1: 0
2: 4
3: 21
4: 245
Right 1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG 0: 1
1: 1
2: 21
3: 256
4: 1594

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138241856 Original CRISPR GAGGAGAAGGAAAATGAGGC AGG Intronic
900458341 1:2787974-2787996 GCAGAAAAGGAAACTGAGGCAGG - Intronic
900509217 1:3050529-3050551 CAGGAGAATGAAGATGGGGCAGG + Intergenic
900656977 1:3763264-3763286 GAGGAGGAGGAAGAGGAGGAAGG + Exonic
900955184 1:5882450-5882472 AAGGAGAAAGAACAAGAGGCGGG - Intronic
901056937 1:6452791-6452813 ACAGAGAAGGAAACTGAGGCTGG - Intronic
901305873 1:8232339-8232361 GAAGAGGAGGAAAAAGAGGGAGG + Intergenic
901305879 1:8232361-8232383 GAGGAGGACGAAAAGGAGGAGGG + Intergenic
901329345 1:8393035-8393057 TAGGAGAAGGAGAATGTGGTGGG + Intronic
901447913 1:9319418-9319440 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
901755981 1:11441860-11441882 GAGGAGGAGGAAGATGAGGGAGG + Intergenic
901755986 1:11441879-11441901 GAGGAGGAGGAAAATGAGGGAGG + Intergenic
901873329 1:12151479-12151501 GAGGAGGAGAAAGATGAGGTTGG - Intergenic
902477438 1:16695704-16695726 ACAGAGAAGGAAACTGAGGCTGG + Intergenic
902772517 1:18653815-18653837 GGGGAGCAGGGAAAAGAGGCTGG - Intronic
903234549 1:21941326-21941348 GAAGAGGAGGAAGAGGAGGCAGG + Intergenic
903772170 1:25770805-25770827 GAGAAGAAAGAAAATGGGGGTGG - Intronic
903950164 1:26991976-26991998 AAGTAGATGGAAACTGAGGCAGG + Intergenic
904078929 1:27859682-27859704 TAGGAGACAGAAAAGGAGGCCGG + Intergenic
904286026 1:29453798-29453820 GAGGAGGAGGAGAAGGAGGGGGG - Intergenic
904295393 1:29516937-29516959 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295740 1:29518748-29518770 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295752 1:29518808-29518830 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904319951 1:29690083-29690105 GAGGAGAAGGAAAGTGAGGAAGG + Intergenic
904375847 1:30081986-30082008 GAGGAGGAGGAACAAGAGGAGGG - Intergenic
904406829 1:30296601-30296623 AAGGATAGGAAAAATGAGGCTGG + Intergenic
904415041 1:30355635-30355657 GAGGAGCAGAGAAATGCGGCAGG + Intergenic
904871061 1:33618623-33618645 GAGGAGGAGGAAGATTAAGCTGG - Intronic
904920148 1:34001013-34001035 GGGGAGGAGGAAAAAGAGGAGGG + Intronic
904994321 1:34619123-34619145 GAGGAGAGGGAAAGGGAGGATGG + Intergenic
905404629 1:37724557-37724579 GAGCAGAGGGAAACTGGGGCAGG + Intronic
905448404 1:38042434-38042456 GAGGAGAAGAAAAAAGGAGCAGG + Intergenic
905810733 1:40911194-40911216 GAGGGCAAGGAAAATGAGGCTGG + Intergenic
905863306 1:41364106-41364128 GGGAAGAGGGAACATGAGGCTGG + Intronic
905942321 1:41873957-41873979 GAGGAGAAGGGAAGCGAGGGTGG - Intronic
905980565 1:42222007-42222029 GAGGAGAAGGAGAAGGGGGAGGG + Intronic
906135158 1:43494237-43494259 GAGCAGCAGGAAATTGAGGAGGG - Intergenic
906180868 1:43817697-43817719 GAGGAGAAGGAGAAGGAAGAAGG - Intronic
906530593 1:46521559-46521581 GTGGAGAAGGAAACCGTGGCTGG - Intergenic
906646579 1:47479393-47479415 GAGGAGAAGGACAAGGCAGCGGG - Intergenic
906777514 1:48543246-48543268 GAGGAGGAGGAACCTGAGGTTGG + Intronic
907303528 1:53502190-53502212 GAAGAGAGGGACAAGGAGGCGGG + Intergenic
907327968 1:53653171-53653193 AAGGAGAAAGAAAAAGTGGCTGG + Intronic
907430623 1:54409191-54409213 TAGAAGAAGGGAACTGAGGCAGG - Intronic
907741140 1:57167087-57167109 GAAGTGAGGGAAATTGAGGCTGG + Intronic
908256673 1:62308916-62308938 GAGATGGAGGAAAAAGAGGCAGG - Intronic
908349138 1:63267006-63267028 GAGGAGGAGGAAGAGGAGGAGGG + Intergenic
908349165 1:63267111-63267133 GAGGAGAAGGAGGAGGAGGTGGG + Intergenic
908390591 1:63679951-63679973 GAGGAGAAGCAAAAAGAGAAGGG - Intergenic
908395913 1:63725542-63725564 GAGCAGAAGGAAAAGGAGCAAGG + Intergenic
908427159 1:64018279-64018301 GAGAAGCAGGAAACTGAGGGAGG - Intronic
908773276 1:67615468-67615490 GAGGTAAAGGAAGATAAGGCTGG + Intergenic
908947791 1:69521250-69521272 GAGGAGGAGGAAGAAGAGGAGGG + Intergenic
909290907 1:73881990-73882012 AAGGAGGAGGAAACTAAGGCTGG - Intergenic
909383161 1:75024564-75024586 GAGGAGGTGGAAGAGGAGGCAGG + Intergenic
909531223 1:76683954-76683976 GAGGAGCAGAGAAATAAGGCAGG - Intergenic
909631896 1:77776562-77776584 GCGGGCTAGGAAAATGAGGCTGG + Intergenic
909693155 1:78433375-78433397 GAGCAGAAGGAAAATTATCCTGG - Intronic
909802200 1:79823834-79823856 GAGGAGACAGAAGATGAGGAAGG - Intergenic
910174495 1:84414494-84414516 GAGGAGAAAGATAGTGAGGTTGG - Intronic
910333029 1:86097591-86097613 GAGGAGAAGGAGAAGGACGAGGG - Intronic
910479350 1:87641462-87641484 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
910484787 1:87701244-87701266 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
910484798 1:87701321-87701343 GAGGAGGAGGCAAAAGAGGCAGG + Intergenic
910547982 1:88440797-88440819 GAGGAGAAGGAGAAAGAAGGAGG + Intergenic
910928135 1:92417127-92417149 GAGAAGAAGGAAAATAAGTCTGG + Intergenic
911010982 1:93280623-93280645 GAAGAAAGGGAAAATGGGGCAGG + Intergenic
911042473 1:93601797-93601819 GAGGAGAAGGGAGAGGAGGCTGG + Intronic
911060714 1:93745514-93745536 GAGGAGAAGAAAAATGGTGGGGG - Intronic
911166378 1:94728360-94728382 GAGCTGGAGGAAAGTGAGGCAGG - Intergenic
911452462 1:98081224-98081246 GAGGAGAAGGAAGAAGAGAAAGG + Intergenic
911474309 1:98357482-98357504 GAGGAGGAGGAGAAGGAGGGGGG - Intergenic
911482920 1:98466844-98466866 GAGGAGAAGGAAGAAGAAGAAGG + Intergenic
911636188 1:100238387-100238409 GAGGAGGAGGAAGAGGAGGAAGG - Intronic
911988092 1:104657342-104657364 GAGGAGAAGAAAAAGTAGGGAGG - Intergenic
911991280 1:104699738-104699760 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
912310276 1:108613892-108613914 GAGGAGGAGGAAAATATTGCTGG - Intronic
912456740 1:109803208-109803230 ACAGAGAAGGAAAATGAGTCAGG + Intergenic
912833161 1:112971536-112971558 GATGAGGAGGATGATGAGGCAGG + Intergenic
912939599 1:114033241-114033263 GAGAAAAAGAAAAATGAAGCAGG - Intergenic
913077387 1:115352506-115352528 GAGAAGCAGGATAAGGAGGCTGG - Intergenic
913163947 1:116168387-116168409 GAGGAGTAGAACAAAGAGGCGGG + Intergenic
913234221 1:116766180-116766202 AGGGAGAAGGACAATGAGCCTGG + Intronic
913288111 1:117246098-117246120 GAGGAGAGGAGAAGTGAGGCAGG - Intergenic
913305403 1:117425109-117425131 GAGGAGAAGGGAAAGGGGGAAGG + Intronic
913314143 1:117535914-117535936 GTGTAGAAGGAAGATGAGTCAGG + Intergenic
913528934 1:119719327-119719349 GAGGGGAAGGGAAAGTAGGCAGG + Intronic
913581786 1:120233736-120233758 GCTGAGAAGGAAAACGTGGCAGG - Intergenic
913582741 1:120243060-120243082 GAGGAGCAGGAGAAAGAGGCAGG - Intergenic
913586109 1:120277426-120277448 GAAGAGAAGGAAATAGAGGGTGG - Intergenic
913622077 1:120620943-120620965 GAAGAGAAGGAAATAGAGGGTGG + Intergenic
913625432 1:120655300-120655322 GAGGAGCAGGAGAAAGAGGCAGG + Intergenic
913626390 1:120664652-120664674 GCTGAGAAGGAAAACGTGGCAGG + Intergenic
913975483 1:143451459-143451481 GTGGAGAAGGAAACCAAGGCCGG - Intergenic
914069876 1:144277075-144277097 GTGGAGAAGGAAACCAAGGCCGG - Intergenic
914109279 1:144689279-144689301 GTGGAGAAGGAAACCAAGGCCGG + Intergenic
914244620 1:145876445-145876467 GAGGAGAAGGAAGAGAAGGGTGG + Intronic
914263615 1:146019622-146019644 GAGGAGGAGGAGGAGGAGGCCGG - Exonic
914387827 1:147188941-147188963 GAGAAGAAGGAAAATGAAGTTGG + Intronic
914563717 1:148845183-148845205 GCTGAGAAGGAAAACGTGGCAGG - Intronic
914564671 1:148854554-148854576 GAGGAGCAGGAGAAAGAGGCAGG - Intronic
914568118 1:148889284-148889306 GAAGAGAAGGAAATAGAGGGTGG - Intronic
914604706 1:149240965-149240987 GAAGAGAAGGAAATAGAGGGTGG + Intergenic
914608155 1:149275688-149275710 GAGGAGCAGGAGAAAGAGGCAGG + Intergenic
914609110 1:149285043-149285065 GCTGAGAAGGAAAACGTGGCAGG + Intergenic
914712417 1:150226753-150226775 GAGGAAGAGGAAAATGAAGCTGG - Exonic
914913185 1:151802639-151802661 GAGGAGGAGGAAAAGGAGCGGGG + Exonic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915137050 1:153739904-153739926 CAGGAGGAGGAGACTGAGGCAGG - Intronic
915301624 1:154954913-154954935 CAGGAAAAGGGAAGTGAGGCTGG + Intronic
915393123 1:155562313-155562335 GAGGAGAAGGGAAAGGTGGAAGG + Exonic
915409278 1:155688219-155688241 GAGGAGAAGGGAAAGGTGGAGGG + Exonic
915480455 1:156181021-156181043 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
915603344 1:156936152-156936174 GAGGAGAAGGAAGGTGATGAAGG - Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916242913 1:162657796-162657818 GAGGAGAAGGGAAAAGAGGAAGG - Intronic
916573717 1:166049178-166049200 GCTGTGAAGGAAAATAAGGCAGG - Intergenic
916579739 1:166096666-166096688 GAGGACAAGAACATTGAGGCAGG - Intronic
916612023 1:166400999-166401021 GAGGAGGAGGAAGAGGAGGAAGG - Intergenic
916666596 1:166973311-166973333 TAGGAGAGGGCAAATGAGACTGG + Intronic
917319876 1:173769399-173769421 GAGGAGAATCAAAATTAAGCAGG + Intronic
917460107 1:175222205-175222227 GAGGAGAAGGAAGGAGAGGGAGG + Intergenic
917881328 1:179339488-179339510 GAGGATAAAGAGAATGAGGAGGG - Exonic
918029703 1:180793829-180793851 GGAGAGAAAGAAAATGAGGGTGG - Intronic
918040493 1:180911665-180911687 GAGGGCGAGGAAAATGAGGCTGG - Intergenic
918056397 1:181025323-181025345 GAGTAGAAGGAAAAGGATGGGGG + Intergenic
918375993 1:183909597-183909619 GAAGACAGGGAAAATGGGGCTGG + Intronic
918727606 1:187945960-187945982 GATAAGAAGGAAAATGATGTAGG + Intergenic
918761550 1:188417146-188417168 GAGGAGGAGGAACAAGAGGAAGG - Intergenic
918840918 1:189538463-189538485 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
919077501 1:192831053-192831075 GAGGAGAGGGTAAAGGAGGTGGG + Intergenic
919191986 1:194232191-194232213 GAGAAGGAGGAGAATGAGGAAGG + Intergenic
919209497 1:194461562-194461584 GAGGAGGAGGAGATTGAGGCGGG + Intergenic
919503613 1:198369615-198369637 GAGGAGAAGGGAAGACAGGCTGG - Intergenic
919763359 1:201111950-201111972 GAGGAGGAGGAAGAGGAGGAGGG - Intronic
919982341 1:202650107-202650129 GAGGAAAAGGGAATTGGGGCTGG + Intronic
920045044 1:203127643-203127665 GAGGAGACGGAGGATGAGGAGGG + Exonic
920062086 1:203233934-203233956 GAGGAGATGGAGCAGGAGGCAGG - Intronic
920079412 1:203361502-203361524 GAGGAGGAGGGAGATGAGGGAGG - Intergenic
920125831 1:203693085-203693107 GAGGGGAAGGAAAACTTGGCAGG - Intronic
920159773 1:203987476-203987498 AAGGAAAAGGAAAATTAGGTGGG + Intergenic
920535927 1:206736540-206736562 GAGGAGAGGAGATATGAGGCTGG + Intergenic
920709921 1:208285508-208285530 GAGGAGAAGGGACCAGAGGCAGG + Intergenic
920952118 1:210582264-210582286 GGGGAGAAGGGAAATAAGGGTGG + Intronic
921067214 1:211631526-211631548 GAGGAGGTAGAAGATGAGGCTGG - Intergenic
921072136 1:211669743-211669765 GAGAAGAAGGAAAATGCCGTAGG - Intronic
921257395 1:213354919-213354941 CAAGAGAGGGAAAATCAGGCTGG + Intergenic
921263492 1:213404000-213404022 TAGGAGAAGGCAGATGAGGGAGG + Intergenic
921295929 1:213703919-213703941 GAGGAGATAGAGAATGAGACAGG - Intergenic
921307541 1:213812179-213812201 GAAGTGAAGGAAAAGGAGGGAGG + Intergenic
921592274 1:217018522-217018544 GCTGAGCAGCAAAATGAGGCTGG - Intronic
921734505 1:218612007-218612029 GAGGAGAAGGAGAAGGGGGTAGG - Intergenic
921780728 1:219159773-219159795 CAGCAGCTGGAAAATGAGGCTGG - Intergenic
921945641 1:220884258-220884280 AAGGACAAGGACAAGGAGGCTGG + Exonic
922067791 1:222160525-222160547 CAGGAGATGGAAGTTGAGGCAGG + Intergenic
922213263 1:223501200-223501222 GAGGGAAAGGAAAAGGAGGAGGG - Intergenic
922279030 1:224105213-224105235 GAATAGAAGGAAAATCAGGATGG + Intergenic
922349340 1:224722838-224722860 GAGGAGAAGGAAACCAAGGCAGG - Intronic
922564703 1:226594088-226594110 GAGGAGGAGGAAAACGAGGCAGG + Intronic
922564737 1:226594289-226594311 GAAGAGGAGGAAAATAAGGCAGG + Intronic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922824942 1:228511467-228511489 GAGGGAAAGGAAGATGAGGAAGG + Intergenic
922967092 1:229699368-229699390 GAGGAGGTGGAAAGGGAGGCAGG + Intergenic
923009551 1:230077264-230077286 GAGGGGAAGGAGAGTGCGGCAGG - Intronic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923161267 1:231316900-231316922 GAGGGGATGGAAAGGGAGGCAGG - Intergenic
923191816 1:231627052-231627074 GAGGTGAGGGAAACTGAGGCAGG + Intronic
923227303 1:231949956-231949978 GAGGATAAGGAGACTGGGGCTGG - Intronic
923355137 1:233147463-233147485 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
923474185 1:234317380-234317402 GAGGAGAAGGGAAGTGAGGGGGG - Intronic
923658542 1:235939123-235939145 GAGGAGGAGGAGAAGGAGGGGGG + Intergenic
923706018 1:236345504-236345526 GGGGGGAAAGAAAATGAGGGTGG - Intergenic
923754407 1:236777558-236777580 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
923762744 1:236862024-236862046 CAGCAGAAGGAAAACAAGGCTGG - Intronic
923810273 1:237307927-237307949 GAAGGCTAGGAAAATGAGGCCGG + Intronic
923810281 1:237307975-237307997 GAGGGCTAGGAAAATGAGGCCGG + Intronic
923810289 1:237308023-237308045 GAGGGCTAGGAAAATGAGGCCGG + Intronic
924010743 1:239662951-239662973 GAGGAGAAGGAAGAGGAGAAAGG - Intronic
924458326 1:244236090-244236112 AAGGAGAAGGAAAGTAAGGTAGG + Intergenic
924802150 1:247335385-247335407 TAGGAGGAGGAAAGTGAGGGAGG + Intergenic
1062882101 10:987721-987743 GAGGAGAAGGTTGATGAGGATGG - Intergenic
1063237141 10:4128763-4128785 GAGGACTAGGAAAACGAGGCTGG + Intergenic
1063286119 10:4690482-4690504 AAAGGGAAGAAAAATGAGGCAGG + Intergenic
1063354263 10:5383114-5383136 GAGCGCTAGGAAAATGAGGCTGG - Intergenic
1063542156 10:6944721-6944743 GTGGGGCTGGAAAATGAGGCTGG + Intergenic
1063606795 10:7529647-7529669 GAGGAGAGGGAAAGGGAGGAGGG + Intergenic
1063736904 10:8767328-8767350 GAAGACAAGGAAACTGAGACAGG - Intergenic
1063997045 10:11629233-11629255 GAAAAGAAGAATAATGAGGCCGG - Intergenic
1064001277 10:11665561-11665583 GAGGAGGAGGAGGAGGAGGCCGG - Intergenic
1064056909 10:12105716-12105738 GAGGAAAAGATAAAAGAGGCTGG - Intronic
1064305158 10:14158807-14158829 GAAGAGAAGGAAGAAGAGGGAGG + Intronic
1064477378 10:15705776-15705798 GAGGTGAAGTGAAATGAGGATGG - Intronic
1064569923 10:16682248-16682270 GAGGGCTAGGAAAATGAGGCTGG + Intronic
1064839393 10:19573518-19573540 GAAGAGAAAGAAAATGAGGGAGG - Intronic
1064993259 10:21274938-21274960 GAGGAGAAGGAAGAGGAGGAGGG + Intergenic
1065021152 10:21502369-21502391 GAGTAGAGGGAAAGAGAGGCTGG + Intergenic
1065065988 10:21965464-21965486 GAGGGCTAGGAAAATGAAGCTGG + Intronic
1065184252 10:23156865-23156887 AAGGAGAAGGAAAGAGAGGGAGG + Intergenic
1065408158 10:25391204-25391226 GTGCAGAAGGAAAATGTGGGTGG + Intronic
1065674402 10:28158591-28158613 GGTGACAAGGGAAATGAGGCAGG + Intronic
1065765652 10:29026997-29027019 GAGGAGAAGGAGGATGAAGAAGG + Intergenic
1065866414 10:29919040-29919062 GAGGAGGAGGAATAGGAGGCAGG - Intergenic
1065866467 10:29919286-29919308 GAGGAGAAGGAGAAGAAAGCAGG - Intergenic
1066065984 10:31761128-31761150 GAGGAGAAGGAAGAAGAGAAAGG - Intergenic
1066347810 10:34606343-34606365 GAGGAGGAGAAAGATGAGGCTGG + Intronic
1066511308 10:36099768-36099790 AAGGAGAAGGAAAATGATATAGG + Intergenic
1066547481 10:36516479-36516501 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1066746459 10:38606486-38606508 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1067394616 10:45903045-45903067 GGGGAGAAGAAAGATGGGGCAGG + Intergenic
1067416183 10:46105181-46105203 GAGGGCTAGGAAAATGAGGAGGG + Intergenic
1067436326 10:46281673-46281695 GAGGGCTAGGAAAATGAGGCGGG + Intergenic
1067450776 10:46380712-46380734 GAGGCCCAGGGAAATGAGGCTGG + Intronic
1067545313 10:47188463-47188485 GAGGAGAAGGAGAAGGAAGTGGG + Intergenic
1067586467 10:47479039-47479061 GAGGCCCAGGGAAATGAGGCTGG - Intronic
1067684311 10:48457774-48457796 GATGAGCAGGAAAGTGAGGAGGG + Intronic
1067807867 10:49405758-49405780 GAGGAGAGAGAAAAGGAGGAAGG - Intergenic
1067862939 10:49872176-49872198 GGGGAGAAGAAAGATGGGGCAGG + Intronic
1067878384 10:50024073-50024095 TGGGAGAAGGAAAAAGAGGGTGG - Intergenic
1067893338 10:50153855-50153877 TGGGAGAAGGAAAAAGAGGGTGG + Intergenic
1068016643 10:51525164-51525186 GAAGAGAAGGAAGAGGAGGAGGG + Intronic
1068056380 10:52016869-52016891 GAGAAGAAGGAAAGGGAGGAGGG + Intronic
1068467593 10:57415089-57415111 GAAGAGAAAGAAGATGAGGAGGG + Intergenic
1068478403 10:57558080-57558102 GAGGAGGAGGAAGAAGAAGCAGG + Intergenic
1068482951 10:57617908-57617930 GGGGAAAAGGAAACTCAGGCTGG - Intergenic
1068496535 10:57790626-57790648 AAGGAAAAAGAAAATGAGGAAGG + Intergenic
1068603075 10:58975852-58975874 TAAGAGAAGGAAATTAAGGCTGG + Intergenic
1068860338 10:61841399-61841421 GGGGAGTAGGAAAGTGAGACAGG + Intergenic
1069176364 10:65293774-65293796 AAGGAAAGGGAAAATGAGGCAGG - Intergenic
1069433893 10:68362493-68362515 GAACAAAAGGAAAATGTGGCTGG + Intronic
1069668746 10:70183624-70183646 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1069718521 10:70535600-70535622 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1069780078 10:70949876-70949898 GAAGAGGAGGCAGATGAGGCAGG + Intergenic
1070028183 10:72651644-72651666 GAGGAGGAGGAAGAGGAGGAGGG + Intergenic
1070086608 10:73244197-73244219 GATAAAAAGGAACATGAGGCCGG + Exonic
1070530734 10:77335142-77335164 GAGGAGGAGGAAGATGGGGAAGG - Intronic
1070590436 10:77796882-77796904 GAGGAGAATGGAGATGGGGCAGG - Intronic
1070906335 10:80076762-80076784 GAGGAGAAGAATAAAGAGGGTGG + Intergenic
1070991644 10:80738705-80738727 GAGAAAAAGGAAAAAGGGGCGGG - Intergenic
1071120690 10:82274042-82274064 TAGGAGGTGGAAAATGAGGCAGG - Intronic
1071324688 10:84501422-84501444 GAGGAGAAGGAGAAAGGGGGAGG - Intronic
1071483402 10:86081229-86081251 GAGGAGCAGAGAAATGGGGCTGG + Intronic
1071676410 10:87659796-87659818 GAGGAGTAGGAGAAGGGGGCTGG + Exonic
1072019378 10:91383130-91383152 GAGTAGAAGGAGGATGAAGCAGG - Intergenic
1072050842 10:91701481-91701503 GAAGAGAAGAAAGATGGGGCAGG + Intergenic
1072061104 10:91811323-91811345 GATGATTAGGAAAATGAGGAGGG - Intronic
1072107881 10:92291271-92291293 GAGGAGGAGGAGCCTGAGGCGGG - Exonic
1072167001 10:92823441-92823463 GAAGATAAAGAAAAAGAGGCCGG + Intergenic
1072329064 10:94328094-94328116 GAGGAGAAGCAAAATGGCACAGG + Exonic
1072834353 10:98695270-98695292 GAGGAGAAGGAGGACGAGGACGG + Intronic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1073028798 10:100508353-100508375 GAGAAGGAGGAAGATGAGGGAGG + Intronic
1073156820 10:101354079-101354101 GGGGGGAAGGAAGAGGAGGCGGG + Exonic
1073378501 10:103058093-103058115 GAGGAGTAGGAAAATGCCGAGGG + Intronic
1073682718 10:105721703-105721725 GGTGAGAAGGAAAATGAGAGAGG + Intergenic
1073742538 10:106425035-106425057 GAGAAGAAGAAAAATTAAGCAGG + Intergenic
1074056236 10:109924596-109924618 GACTTGAAGGAAAATGAGGAAGG - Intergenic
1074169613 10:110919595-110919617 GAGGAGGAGGAAGAGGAGGAAGG + Exonic
1074201796 10:111243967-111243989 AAGGAAAAGAAAAATGAGGGAGG + Intergenic
1074321340 10:112406010-112406032 GAGGAGATGGAAAGAGAGGCAGG + Intronic
1074570858 10:114622749-114622771 GAGGAGAAGGAAGAAGAGGAGGG - Intronic
1074691126 10:116005054-116005076 GAGGAGAAGGAGATGGAGGGGGG - Intergenic
1074712669 10:116190441-116190463 CAGGAGAAGGAAAGGGAGCCTGG + Intronic
1074905376 10:117858127-117858149 GAGGTGAAGGGAAATGAAGTAGG - Intergenic
1074910226 10:117901778-117901800 GAGGAGGAGGAAGAAGAGGAGGG + Intergenic
1075240456 10:120773856-120773878 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
1075389123 10:122079639-122079661 GAGGAGCAGGACAGAGAGGCTGG + Intronic
1075403430 10:122177635-122177657 GAGCAGCAGGAGAATGAAGCTGG + Intronic
1075425939 10:122341757-122341779 GATAAGAAGGAAGCTGAGGCCGG + Intergenic
1075622288 10:123936822-123936844 GAGGAAGAGGAAGATGAGGAAGG - Intronic
1075637925 10:124042934-124042956 GAGGAGAGAGAACATCAGGCAGG - Intronic
1075779107 10:125005495-125005517 GGGGAGGGGGAAAATAAGGCAGG + Intronic
1076038304 10:127220294-127220316 CAGGAGAATGAAGAGGAGGCAGG + Intronic
1076060963 10:127413590-127413612 GACGAGGAGGAAGATGAGACAGG + Intronic
1076077354 10:127545062-127545084 GAGGAGAGGGAAAAGGAGGGAGG - Intergenic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076270685 10:129149787-129149809 CACAAGAAGGAAACTGAGGCTGG + Intergenic
1076293832 10:129368488-129368510 GAGGATGAGGAAACTGAGGCAGG + Intergenic
1076319033 10:129564695-129564717 GAGGAGGAGGAAGAGGAGGAAGG - Intronic
1076565783 10:131398184-131398206 GAGAAAAGGGAAAATGAGGCAGG - Intergenic
1076668954 10:132108618-132108640 GAAGAGCAGGTGAATGAGGCAGG - Intronic
1076749113 10:132533385-132533407 TAGGAGGAGGAAAATCGGGCAGG + Intergenic
1076809432 10:132878943-132878965 GAGGAGCAGGACAAGGAGGGGGG + Intronic
1077017806 11:404653-404675 GAGGAGAAGGCTAATGACGGAGG + Exonic
1077160300 11:1109621-1109643 GAGGGAAAGGAGAATGAGCCCGG - Intergenic
1077392601 11:2307022-2307044 GAGGAGGAGGAAGAGGAGGAAGG + Intronic
1077432882 11:2524792-2524814 GTTGATAAGGAAACTGAGGCAGG + Intronic
1077640621 11:3878188-3878210 GGGGAGAAGGGAAAGGAGGAGGG + Intronic
1077695523 11:4389473-4389495 GAGGGGAATAAAAATGATGCAGG - Intronic
1077778648 11:5300341-5300363 GGGAAGAAGGAAAACGGGGCTGG + Intronic
1077955343 11:7013356-7013378 GTTGTGAAGGAAACTGAGGCAGG + Intronic
1078135795 11:8650450-8650472 GAGCAGAAGGAAAAGGAGGAAGG + Intronic
1078140946 11:8692620-8692642 GAGGGGAAGGAAACTTAGGATGG + Intronic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1078468146 11:11565524-11565546 GAGCAGAAGAAAAAGGAGGCTGG + Intronic
1078760261 11:14245826-14245848 AAGGAGAAGCAACACGAGGCAGG + Intronic
1079110515 11:17602660-17602682 GAGGAGGAGGAGCATGAGGAGGG - Intronic
1079620278 11:22545687-22545709 GAGGAGAAGGAAACAGATGTAGG - Intergenic
1079691450 11:23423371-23423393 CAGCAGAAGGCAAATGATGCGGG - Intergenic
1079703936 11:23589047-23589069 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1079822536 11:25148455-25148477 GACGAGAAGGGAAAGGAGGGAGG + Intergenic
1080003348 11:27376681-27376703 TAAGAGAAGGAAGATGATGCAGG + Intronic
1080304364 11:30820541-30820563 GTGGAGTAGGAAGATGGGGCTGG + Intergenic
1081156082 11:39692856-39692878 GAGGAGGTGGAAAAGGAGACAGG - Intergenic
1081184566 11:40026234-40026256 GAAGAGGAAGAAAATGAGGATGG + Intergenic
1081318854 11:41665930-41665952 AAGAAGAGGGAAAATAAGGCTGG - Intergenic
1081351903 11:42064387-42064409 GAGGACTAGGAAAATGAAGCTGG + Intergenic
1081489696 11:43557882-43557904 GTGGAGAAGCTAAATGGGGCAGG + Intronic
1081665001 11:44911615-44911637 GAGGAGGGGGAAAGGGAGGCTGG - Intronic
1081732255 11:45379883-45379905 GAGGAGGAGGATAAGGATGCAGG - Intergenic
1082040513 11:47681031-47681053 CAGTAAAAGGAAAATGAGGCTGG + Intronic
1082079296 11:47999778-47999800 AAGGAGAAGGAAAACTAGGGGGG + Intronic
1082762099 11:57136932-57136954 GAGGAGGAGGAAAAGGAAGGAGG + Intergenic
1082771559 11:57211558-57211580 GAGGAGATGGAAGGGGAGGCGGG - Intergenic
1082874550 11:57974804-57974826 GTGGAGAAAGAAAAGGAGGCAGG - Intergenic
1082987475 11:59180995-59181017 GAGAAGAAGGGAAATCAGGTTGG - Intronic
1083050085 11:59769274-59769296 GAGGAGGAGGAGGATGAGGATGG + Intronic
1083287340 11:61668600-61668622 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1083291453 11:61692617-61692639 GGGGAGAAGGAACACCAGGCTGG + Intronic
1083319678 11:61838109-61838131 GAGGAGAAGGAAAATGAAACTGG - Intronic
1083477061 11:62921546-62921568 GAGGAGAAAGGACATGAGGAAGG + Exonic
1083966822 11:66048609-66048631 GGGGAGGAGGAAAAAGAGGGAGG - Intronic
1084092195 11:66886080-66886102 GAAGTGAAGGATGATGAGGCGGG + Intronic
1084164576 11:67369483-67369505 GAGGAGAAAGGAACTGAGTCAGG - Intronic
1084279321 11:68076939-68076961 GGAGAGGAAGAAAATGAGGCCGG + Intronic
1084393408 11:68892696-68892718 GAGGAGAAGGGGAGCGAGGCTGG + Intronic
1084412540 11:69012993-69013015 GCAGGGAAGGAAAATGACGCGGG - Intronic
1085055070 11:73398553-73398575 GAGGGGAAGGAAACAGAGGCTGG + Intergenic
1085145900 11:74196991-74197013 GAGGGCTAGGAAAATGAGGCTGG - Intronic
1085257785 11:75186062-75186084 GAGGGGTAGGAAAATGAGGCTGG - Intronic
1085855375 11:80170154-80170176 GAGGAGATTGAAGAGGAGGCAGG - Intergenic
1085871877 11:80359766-80359788 GAGGAGGAGGAAAAAGAGAAGGG + Intergenic
1086316665 11:85602103-85602125 GAGGAGAAGCAGACTGAGGGTGG - Intronic
1086386677 11:86316212-86316234 GAGGAAAAAGAAAAGAAGGCCGG + Intronic
1086689831 11:89776899-89776921 GATGAAAAGGAAAAAAAGGCCGG - Intergenic
1086716024 11:90063057-90063079 GATGAAAAGGAAAAAAAGGCCGG + Intergenic
1086952596 11:92906235-92906257 GAGGAAAAGGAAGAGGAGGAGGG + Intergenic
1086998899 11:93392923-93392945 GAGGAGGAGGAAGAGGAGGGAGG - Intronic
1086998906 11:93392945-93392967 GAGGAGGAGGAAGAGGAGGGAGG - Intronic
1087058144 11:93953264-93953286 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1087414707 11:97839309-97839331 GAAGAAAAGGAAAAGGAGGGTGG + Intergenic
1087526061 11:99314746-99314768 GAGGAGAAAGAAGAAGAGGATGG + Intronic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087804656 11:102542882-102542904 GAAGTGACAGAAAATGAGGCTGG - Intergenic
1087957367 11:104304946-104304968 GAGGAGAAGGGAAAAGAGAAAGG - Intergenic
1088109477 11:106245788-106245810 GAGCAGAAGCAAAATGGGGGAGG - Intergenic
1088462048 11:110092862-110092884 GAGGAGAAGGAAAAGAGGGAAGG + Intergenic
1088578640 11:111296883-111296905 GAGGGGAAGGACAATGGGGGTGG - Intergenic
1088592124 11:111412902-111412924 GGGGAGAAGGAAAATGGGTTGGG + Intronic
1088741787 11:112773560-112773582 GAGGAGAGGAGAGATGAGGCTGG + Intergenic
1088822881 11:113471474-113471496 GAGAAGAGGGAAAATGGTGCTGG + Intronic
1088900834 11:114115805-114115827 GGGGAGAAGGACAGAGAGGCAGG + Intronic
1088920554 11:114257494-114257516 GTGGAGAGGGAAAATAAGGTGGG - Intergenic
1088943460 11:114484403-114484425 GAGGAGAAAGAAAAAGAGAGAGG - Intergenic
1088969034 11:114755137-114755159 GAGGAGCAGAAAAATGGGGTTGG + Intergenic
1089056300 11:115587957-115587979 GAGGAGAAAGAAAAAAAAGCAGG - Intergenic
1089074428 11:115727057-115727079 GAGGAGGAGGAAGAGGAGGAAGG + Intergenic
1089111118 11:116057491-116057513 GGGGAGGAGGAGAATGAGGTTGG + Intergenic
1089453070 11:118610347-118610369 GAAGGGAAGGAAACTGAGGCGGG - Intronic
1089513791 11:119018683-119018705 GAGGAGGAGGAGGAGGAGGCTGG + Exonic
1089516782 11:119037818-119037840 GAAAAGAAAGAAAATTAGGCCGG + Intergenic
1089593768 11:119561554-119561576 GAGGGGAAGGAAAAAGAGGAAGG - Intergenic
1089656010 11:119947572-119947594 GAGGAGAAGGAAGCTGGGACAGG + Intergenic
1089991699 11:122867475-122867497 GAAGAGTATGAAAATGAGGAAGG - Exonic
1090168717 11:124579373-124579395 GAGGAGGAGGAAGAAGAGGGAGG + Intergenic
1090442407 11:126735413-126735435 GAGGAGGTGGGAAATGGGGCCGG - Intronic
1090521375 11:127483098-127483120 CAAGAGAAGGAAAAGGTGGCTGG + Intergenic
1090685966 11:129119901-129119923 GAAGAGAAGAAAGATGAGGTCGG + Intronic
1090703189 11:129314701-129314723 GAGGGGAAGGAAAGGAAGGCAGG - Intergenic
1090806397 11:130204976-130204998 GAGGTGAGGGAAAATGAAGCGGG + Intronic
1090848613 11:130550835-130550857 GAGGAGGAGGAATAGGAGGAAGG - Intergenic
1090862442 11:130666106-130666128 GAGGAAAAGGAAGACGAGGAGGG - Intergenic
1091195951 11:133730843-133730865 GATGTAAAGGAAAATGAGCCAGG - Intergenic
1091326324 11:134691330-134691352 GAGGAAACGGAAAAGGGGGCAGG - Intergenic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1091394965 12:148569-148591 GAAGAGAAGGAAGCTGATGCAGG - Intronic
1091515780 12:1179801-1179823 GATATGAAGAAAAATGAGGCCGG - Intronic
1091692090 12:2604254-2604276 GAGGAGAAGGGGACTGAGACAGG + Intronic
1091770234 12:3146665-3146687 GTGGAGAAAGATAAGGAGGCAGG - Intronic
1091832304 12:3558239-3558261 GAGGAGAAGGAAGGGGAGGAAGG - Intronic
1091899757 12:4135147-4135169 GAGGAGCAGGGAAAGGGGGCAGG + Intergenic
1092143165 12:6198061-6198083 GAGGACAAGGAAGGAGAGGCAGG - Intergenic
1092269742 12:7013947-7013969 GAAGTGATGGAAAATCAGGCTGG - Intronic
1092444421 12:8540846-8540868 GAGGAGAAAGAAAGAGAGGGAGG - Exonic
1092518253 12:9238518-9238540 GAGATGAAGGAAATTGAGGGAGG + Intergenic
1092932775 12:13332675-13332697 GAGGAGGAGGAAGAAGAGGACGG - Intergenic
1093307286 12:17536951-17536973 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
1093508374 12:19896631-19896653 GAGGAGGAGGAAGAGGAGGAGGG - Intergenic
1093775334 12:23067157-23067179 GAGGAGAAGGAAGAAGAGAAAGG - Intergenic
1094003455 12:25721792-25721814 CAGGGGAAGGGAAATGAGGGTGG + Intergenic
1094192602 12:27712237-27712259 GGGAAGAAGGACAATGTGGCAGG + Intronic
1094234390 12:28146896-28146918 GAGGAGGAGGAAGAGGAGGGGGG - Intronic
1094469027 12:30785580-30785602 AAGGAGAAAAAAAAAGAGGCTGG + Intergenic
1094582460 12:31746651-31746673 GATGAGGAGAAAAAAGAGGCAGG + Intergenic
1095154377 12:38834369-38834391 GGGGAGAAGGAGATTGAGGCAGG - Intronic
1095255304 12:40028306-40028328 GAAGAGGAGGAAAAAGAGGTTGG - Exonic
1095578190 12:43763699-43763721 GAGGGGAGGGAAAATGGGGGTGG - Intronic
1095610421 12:44121413-44121435 GAGGAGGAGGAATAAGAGGAGGG - Intronic
1095710969 12:45287623-45287645 GAGAATAAGGAAAAGGAGTCAGG + Intronic
1095716963 12:45356664-45356686 GAGGAGGAGGAAAAAGAGTAGGG + Intronic
1095824746 12:46519461-46519483 GAGAAGAAAGAAAAAGAGGCAGG - Intergenic
1095952255 12:47787996-47788018 CAGGAGGAGGTCAATGAGGCTGG + Intronic
1096152841 12:49325467-49325489 GAGGAGAAGGAAAAGGAAGGGGG - Intronic
1096231594 12:49899939-49899961 GAGGATATGGGAAATGAGGAAGG + Intronic
1096424633 12:51490744-51490766 AATGAGAAGGAAAGAGAGGCAGG + Intronic
1096595024 12:52689515-52689537 GAGGAGGAGGAAGAGGAGGAAGG + Intergenic
1096717353 12:53499491-53499513 GAGGAGAAGGAGGAGGAGGCGGG - Intronic
1097170130 12:57108101-57108123 AAGGAGAAGGAAGATGAGTTAGG + Intronic
1097212049 12:57378667-57378689 GAGAAGAATGAAAAATAGGCTGG - Intronic
1098024351 12:66186990-66187012 GAGGAGAAGGAATTGGAGTCGGG + Intergenic
1098035642 12:66299608-66299630 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1098060893 12:66561198-66561220 GAGTGGAAGGAAAGTGAGGATGG + Intronic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098395033 12:70008021-70008043 AAGAAGCAGGAAAAAGAGGCGGG - Intergenic
1098445633 12:70563119-70563141 GAGGAGCAAGAGAATGAGGGAGG + Intronic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098528711 12:71516110-71516132 GAGGAAAAGGAGAATGAGGGAGG + Intronic
1098754170 12:74337142-74337164 GTGGAGAAGGAAAATGTGGTAGG + Intergenic
1099442418 12:82714640-82714662 GAAGCGAAGGAAAATGAGGGAGG - Intronic
1099600279 12:84726728-84726750 GAGGAGGTGGAAGATGAGGCAGG + Intergenic
1099643391 12:85319524-85319546 GAGGAGGAGGACAAAGAGGAGGG - Intergenic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1099997983 12:89800065-89800087 GCTGATAAGAAAAATGAGGCAGG - Intergenic
1100136120 12:91555686-91555708 GAGGACACTGAAAATGAGACAGG - Intergenic
1100673782 12:96844872-96844894 AAGGAGCAGGAAACTGAGTCAGG - Intronic
1100773233 12:97947109-97947131 GGGAAGAAAGAAAAAGAGGCTGG + Intergenic
1101555718 12:105807243-105807265 CATGAGAAGGACAATGAGGGAGG - Intergenic
1101610016 12:106282806-106282828 TAGGAGGAGAAAATTGAGGCTGG - Intronic
1101705131 12:107214491-107214513 GAGAGGAAAGAAAATGAGGCAGG + Intergenic
1101901192 12:108792395-108792417 GAGGAGACGGAAAGGGAGGAGGG - Exonic
1101987682 12:109460561-109460583 GCAGAGAGGGAAAATGAGGAAGG + Intronic
1102536761 12:113587697-113587719 AAGGAGAAGGAAAAGGAGTGGGG - Intergenic
1102558762 12:113747353-113747375 CAGGAGAAGGCAAACCAGGCTGG - Intergenic
1102591525 12:113959878-113959900 GAGAAGAAGAAAAAGGTGGCAGG - Exonic
1102808097 12:115799708-115799730 GAGGAGGAGGAAGAGGAGGAGGG + Intergenic
1102809344 12:115810569-115810591 GGAGAGAAGGGAAATGGGGCTGG + Intergenic
1102822962 12:115923841-115923863 GAGGAGAAGGAGAAGGGGGTGGG - Intergenic
1102974966 12:117200150-117200172 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1102999914 12:117377465-117377487 GAGGAGAAGGAAGGTTAGCCAGG + Intronic
1103034680 12:117646954-117646976 GAGGAGAGGGAGAAAGAGCCAGG + Intronic
1103050606 12:117776163-117776185 GAGGGGAAGGAATATGGGGTTGG - Intronic
1103131954 12:118477026-118477048 GAGGAGAAAGAAAGGGAGGAAGG - Intergenic
1103230713 12:119328208-119328230 GGGGAGTGGGAAAATGAGACAGG + Intergenic
1103263332 12:119608465-119608487 AATGAGAAGGAAAATGAAGGAGG + Intronic
1103317280 12:120066338-120066360 GAGGAGAAGGAAAATAAGTATGG + Intronic
1103563372 12:121803957-121803979 GAGGAGGAGGAAGAGGAGGAGGG + Intergenic
1103603454 12:122069258-122069280 AAAGAAAAGGAAAAAGAGGCTGG - Intergenic
1103658477 12:122494184-122494206 CAGGAAAAGAAATATGAGGCAGG - Intronic
1103659275 12:122500707-122500729 GAGGAGGACGAAAATGGGGTCGG - Intergenic
1103825101 12:123731794-123731816 GAGGAGAGGGAGGATGTGGCTGG - Intronic
1104161862 12:126189027-126189049 GAGGGCTAAGAAAATGAGGCTGG + Intergenic
1104253803 12:127122667-127122689 GAGAATATGTAAAATGAGGCTGG + Intergenic
1104361420 12:128136775-128136797 GAGGAGGAGGAACAAGAGGAGGG + Intergenic
1104382139 12:128316346-128316368 GTGGGGAAGGAAACTGAGGAAGG - Intronic
1104488475 12:129172919-129172941 GAGGAGAGGGAAAATGATGGGGG + Intronic
1104524282 12:129503850-129503872 GAGGAGGAGGAAAATCTGGAAGG - Intronic
1104604331 12:130176940-130176962 TAAGAGAAAGAAAATGGGGCTGG + Intergenic
1104616388 12:130273443-130273465 GAGGAGAAGGAAGAAGAAGAAGG - Intergenic
1104683553 12:130768972-130768994 AAGGAAAAGAAAAATGAGGCCGG + Intergenic
1104714397 12:131006692-131006714 GAGGATGAGGGAAATGAGGAGGG + Intronic
1104722293 12:131051297-131051319 GAAAAGAAGGAAAATGAAGCAGG - Intronic
1105008373 12:132737284-132737306 GCAGTGGAGGAAAATGAGGCTGG - Intronic
1105038535 12:132943836-132943858 AGGGCGAGGGAAAATGAGGCTGG + Intronic
1105323303 13:19347556-19347578 GTGGAAAAGGAAACTGATGCAGG + Intergenic
1105483631 13:20803833-20803855 GAGGGCTAGGAAAATGATGCTGG + Intronic
1105675417 13:22666309-22666331 GAGGAGGAGGAAGAGGAGGTTGG - Intergenic
1105782053 13:23714352-23714374 CAGGAGAAGAAAAAAGAGGTTGG - Intergenic
1105874086 13:24538282-24538304 GTGGAAAAGGAAACTGATGCAGG - Intergenic
1105967724 13:25399723-25399745 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1106243061 13:27925387-27925409 GAGGAGGAGGAGAAAGAGGAGGG - Exonic
1106358477 13:29007614-29007636 GAGGAGGAGGAGAAAGAGGAGGG - Intronic
1106389962 13:29325504-29325526 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1106423620 13:29604798-29604820 GAGGAGGAGGAAGAAGAGGAGGG - Intergenic
1106717328 13:32405211-32405233 GATAAAAAGTAAAATGAGGCCGG + Intronic
1106736618 13:32593850-32593872 GAGGAGGTGGAAGAGGAGGCAGG + Intronic
1106774719 13:32997799-32997821 GATGAGGAGGAAAAGGAGGTTGG - Intergenic
1106810129 13:33350659-33350681 GAGGAGAAGGAAAGTGGGAAAGG - Intergenic
1107106620 13:36650040-36650062 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1107131388 13:36900067-36900089 GAGTAGAAGGAAAAGAAGGCAGG - Intronic
1107329053 13:39277866-39277888 GGGGAGAAGGAAAGGGAGGGTGG - Intergenic
1107416976 13:40209994-40210016 CTAGAAAAGGAAAATGAGGCCGG + Intergenic
1107427688 13:40310143-40310165 CAGGAGATGGAAAACCAGGCAGG + Intergenic
1107907393 13:45073936-45073958 GAGCAGGAGGAAAAGGGGGCGGG + Intergenic
1108343620 13:49522337-49522359 GATGAGCATGAAAATGAAGCTGG + Intronic
1108542012 13:51453431-51453453 GAGGGGAGGGAAAAAGGGGCTGG + Intronic
1108560426 13:51638001-51638023 GAGGGCTAGGAAAATGAGGCTGG - Intronic
1108717062 13:53091566-53091588 GAGGAGAAGCAAAGTGGGGAGGG + Intergenic
1108744972 13:53384111-53384133 GAGGAGGAGGAGAAAGATGCAGG - Intergenic
1108790273 13:53961529-53961551 GAGGAGAAGGGAAGGGAGGGAGG - Intergenic
1109015682 13:57009650-57009672 AACGAGAAGTAAACTGAGGCTGG - Intergenic
1109208085 13:59504076-59504098 GAGGAGAAAGGAAATGATCCAGG - Intergenic
1109268272 13:60225448-60225470 GCTAAGAAGGAAAATGAAGCTGG - Intergenic
1109287365 13:60425753-60425775 GAGGAGGAGGAAGAAGAGGAGGG - Intronic
1110347288 13:74463352-74463374 CAGGACAAAGAAAATCAGGCTGG - Intergenic
1110382188 13:74865629-74865651 AAAGAAAAGGAAAATGATGCTGG - Intergenic
1110637552 13:77783395-77783417 GAGGAGAAGGAGAGGGAGGAGGG + Intergenic
1110652006 13:77952507-77952529 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
1110666159 13:78119493-78119515 GAGGAGGAGGACAAGGAGGGAGG - Intergenic
1110875419 13:80503765-80503787 AAGGAGAATGAAACTGAGCCAGG + Intergenic
1111104556 13:83628849-83628871 CAGGAGAAGGAGAGTGAGGGGGG - Intergenic
1111106178 13:83648512-83648534 GAGGAGAAGGAAAAAGGAGAAGG + Intergenic
1112164729 13:96906148-96906170 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1112373881 13:98820863-98820885 GAGGGCTAGGAAAATGAGGCTGG - Intronic
1112492234 13:99877379-99877401 CAGGGCAAGGAAAATGAGGGTGG - Intronic
1112542282 13:100326671-100326693 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1112788991 13:102982808-102982830 AAGGAGGAGGAAGATGAGGAGGG + Intergenic
1112819664 13:103316862-103316884 GAGGAAAATGAAAATGGCGCAGG + Intergenic
1112884510 13:104152082-104152104 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1113011537 13:105773061-105773083 GAGGTGAAAGAAAGAGAGGCAGG + Intergenic
1113129985 13:107025050-107025072 GAGCACAAGGAATATGAGGAGGG + Intergenic
1113163936 13:107416428-107416450 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1113175644 13:107560257-107560279 GAAAAGGAGGAAAATGAGGATGG + Intronic
1113242209 13:108350460-108350482 GAGAGGAAAGAACATGAGGCCGG - Intergenic
1113694813 13:112337295-112337317 GAGGAGAATGAGGACGAGGCTGG + Intergenic
1113909847 13:113836632-113836654 GAGGAGAGGGGAAATAAGGATGG + Intronic
1113909859 13:113836660-113836682 GAGGAGGGGGAAAAAGAGGAGGG + Intronic
1114207020 14:20581611-20581633 TAGGAGAAGGAAGCTGAGGATGG - Intergenic
1114257296 14:21014297-21014319 AAAGAGAAGGAAAAAGAGGAAGG + Intergenic
1114460358 14:22882694-22882716 GTGGAGAAGGAAAAGGTGGCAGG + Intergenic
1114483579 14:23049575-23049597 GAGGAGAAGGGGACAGAGGCAGG + Intronic
1114554105 14:23551649-23551671 GAGGAGGAGGAGGAGGAGGCAGG - Exonic
1114557268 14:23569193-23569215 GAGGAGGAAGAAAATGAAGAAGG - Exonic
1114557314 14:23569557-23569579 GAGGAGAAGAGAAAAAAGGCAGG + Exonic
1114671859 14:24415761-24415783 CAGGAGAAGGAAAGGGAGACAGG - Exonic
1114999956 14:28410125-28410147 GAAGAGAAGGAAAAAGAAGGAGG + Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115300646 14:31881544-31881566 GAGGAGAAGGACAAGGTGACGGG - Intergenic
1115303107 14:31906406-31906428 GAGGAGGAGGAAGAAGAGGAGGG - Intergenic
1115314310 14:32010079-32010101 GTGGAGGAGGAAAATGTGGGTGG + Intronic
1115399424 14:32939833-32939855 GAGGAGCAGGAGGAGGAGGCCGG + Intronic
1115546018 14:34465374-34465396 GAGGATAAGCAAAATAAGGAAGG + Intergenic
1115761714 14:36582842-36582864 GAGGAGGAGGAAGCTGGGGCTGG - Intergenic
1115815567 14:37160957-37160979 GAGGAGGAGGAGAAAGAGGAAGG + Intronic
1116023795 14:39491937-39491959 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116788943 14:49318910-49318932 GAGGAGAAGGGAAGGGAGGGAGG + Intergenic
1116827150 14:49683701-49683723 AAGGAAAGGAAAAATGAGGCAGG + Intronic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117953861 14:61107900-61107922 GAGCAGAGGAAAAGTGAGGCCGG + Intergenic
1117978701 14:61321695-61321717 GAGGAGAAGCAAGAGGAGGCGGG + Exonic
1118773738 14:68960184-68960206 GAGGAGGAGGAAGGGGAGGCAGG + Intronic
1118840265 14:69504617-69504639 TAGAAGAAGAAAAATGAGGGTGG - Intronic
1118908408 14:70040803-70040825 GAGGAGAAGGGAACTGTGGGAGG + Intergenic
1119055714 14:71417652-71417674 GAGGAGGAGGAAGGGGAGGCAGG + Intronic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1119523149 14:75301272-75301294 GTGGAGATGGTAAATGAGGCTGG + Intergenic
1119640176 14:76308871-76308893 GAGGAGAAAGAAAATCATGGAGG + Intergenic
1119691864 14:76679321-76679343 GAGGGCTAGGAAAATGAGACTGG + Intergenic
1119707515 14:76793444-76793466 GAGGAGAAGGAAGAAGAGGGAGG + Intronic
1119898771 14:78242823-78242845 GAAGAGGAGGAAAATCAGGTGGG - Intronic
1119949960 14:78734839-78734861 GAGGAGAGGGAAGAGGAGACAGG + Intronic
1119996840 14:79262480-79262502 GAGAAGGAGGAGAATGAGGAAGG + Intronic
1120193981 14:81463372-81463394 GAGGAGAAGGACAATTAGGAGGG - Intergenic
1120262834 14:82209261-82209283 GAGGAGGAGGAGAAAGAGGTGGG + Intergenic
1120289956 14:82555884-82555906 GAGGAGCAGGAAATTGTGACTGG - Intergenic
1120863162 14:89273240-89273262 TAGGAGGTGGAAACTGAGGCTGG - Intronic
1121004177 14:90477649-90477671 GAGGAGGAGGAAGAAGGGGCAGG + Intergenic
1121006379 14:90493207-90493229 GAGGAGGAGGAAAAAGAGGAGGG - Intergenic
1121043049 14:90765940-90765962 GAGAAAGAGAAAAATGAGGCTGG - Intronic
1121144207 14:91569434-91569456 AAGGAGGAGGAAAAAGAGGAAGG - Intergenic
1121219472 14:92274922-92274944 CAGGAGAAGGAAGGTGAGGCGGG - Intergenic
1121310184 14:92931591-92931613 GAGGAGGAGGAGGCTGAGGCTGG + Exonic
1121310469 14:92932807-92932829 GAGGAGAAGAAAGAGGAGGAGGG + Exonic
1121488159 14:94336347-94336369 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1121978124 14:98425094-98425116 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1122047493 14:99034435-99034457 GAGGGGGAGGAAAAGGAGGGAGG + Intergenic
1122284798 14:100644421-100644443 GAGGTCAAGCTAAATGAGGCCGG - Intergenic
1122322219 14:100861967-100861989 GAGGAGGAGGAAGAGGAGGGAGG - Intergenic
1122377863 14:101278578-101278600 GAGGAGAAAGAAGGTGGGGCTGG + Intergenic
1122451077 14:101808094-101808116 GAGGAGGAGGAGGAGGAGGCTGG + Intronic
1122537165 14:102473509-102473531 GTGGAAAAGGAAATGGAGGCAGG + Intronic
1123539257 15:21271709-21271731 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1123927217 15:25128094-25128116 GAGGAGGAGGAAGAAGAGGAGGG + Intergenic
1124208825 15:27745531-27745553 GAGGGCTAGGAAAATAAGGCTGG - Intergenic
1124816731 15:33001538-33001560 GAGGAGGAGGAGGATGAGGGGGG - Intronic
1124957761 15:34370870-34370892 GAAGAGGAGGAAAAGGAGGAGGG - Intergenic
1124957776 15:34370922-34370944 GAGGAGAAGGGAAGTGAGGAAGG - Intergenic
1124957816 15:34371077-34371099 GAGGAGGAGGAAGAGGAGGAGGG - Intergenic
1124959484 15:34383748-34383770 GAGGATGAGGAAAATGTCGCAGG - Exonic
1124976110 15:34529969-34529991 GAGGATGAGGAAAATGTCGCAGG - Exonic
1125106551 15:35978559-35978581 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1125253713 15:37737481-37737503 AAGGAGAAGGAAAAGCAAGCAGG - Intergenic
1125311670 15:38385897-38385919 GAGGAGATGGAAGGTGAGGGAGG - Intergenic
1125428520 15:39573619-39573641 GAAGAGAAAGAAAAAGAGGAAGG + Intergenic
1125697553 15:41651803-41651825 GAGGAGAAGGGAAAGGAAGAGGG - Intronic
1126052308 15:44697158-44697180 GAGGAGAAGGAGGAGGAGGAAGG - Intronic
1126354434 15:47780241-47780263 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1126623766 15:50666505-50666527 GAGGAAAAAGAAAAAGAGGCCGG + Intronic
1126870425 15:52981231-52981253 GAGGAGAGGGAAAGTGAAACAGG - Intergenic
1126988550 15:54343470-54343492 GAGGAGTAGGAAACTGAACCTGG - Intronic
1127029440 15:54845487-54845509 AAAGAGCAGGAAAAGGAGGCGGG + Intergenic
1127071860 15:55295201-55295223 AAGGAGAAGGAAAGGGAGGGAGG + Intronic
1127114090 15:55706781-55706803 GAGGAGAGGGAGAGCGAGGCAGG + Intronic
1127120941 15:55771603-55771625 GAAGAGACAGCAAATGAGGCTGG + Intergenic
1127372775 15:58356300-58356322 GAGGAGGAGGGAAATGCTGCAGG - Intronic
1127582339 15:60349830-60349852 GAGGGGAAGGAAAGGGAGGGAGG + Intronic
1128114760 15:65098226-65098248 GAGGAGAGGGTGCATGAGGCAGG - Intronic
1128370532 15:67036004-67036026 GAGGAGAAGGGAAGTGAGGTGGG - Intergenic
1128668157 15:69553728-69553750 GAAGAGAAGGAAGAAGAGGCAGG - Intergenic
1128896415 15:71377599-71377621 GAGGATAAGGAGAAAGAGGGCGG + Intronic
1129077836 15:73012639-73012661 GAGGAGAAGGGAGGTGAGGGAGG - Intergenic
1129257030 15:74339439-74339461 GAGGAGAAAGAAATAGAGCCAGG - Intronic
1129294066 15:74590020-74590042 TGGGAGAAGGAAGCTGAGGCTGG + Intronic
1129314438 15:74732688-74732710 GAGGAGGAAGAGAATGAGGCAGG - Intergenic
1129647290 15:77448335-77448357 GAGGAGGTGGCAAATGTGGCTGG - Intronic
1129675895 15:77632403-77632425 GAGGAGGAGGAAACGGAGGAGGG - Exonic
1129917795 15:79289669-79289691 AAGGAGAAGGAAAAGAAGGTGGG - Intergenic
1130022231 15:80241304-80241326 GAAAAGAAGGAACAGGAGGCAGG - Intergenic
1130225994 15:82058820-82058842 GAGGAGAGGGAAGAGGAGGGAGG - Intergenic
1130233540 15:82114298-82114320 GAGGAGAAGGGAGATGGTGCTGG + Intergenic
1130311932 15:82763855-82763877 GAAGAGGTGGAAGATGAGGCAGG - Intronic
1130635842 15:85619160-85619182 GAGGAGGAGGAAGAAGAAGCGGG + Intronic
1130719597 15:86373532-86373554 GAGGAGAAGGTACACTAGGCAGG + Intronic
1130956281 15:88629515-88629537 GAAGAGAATGACAAGGAGGCTGG - Intronic
1131338383 15:91572231-91572253 GAGCAGAGGGAATAAGAGGCTGG + Intergenic
1131399041 15:92110014-92110036 GAGGAGAAAGGGAATCAGGCTGG + Intronic
1131430147 15:92380754-92380776 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1131573288 15:93561020-93561042 ATGGAAAAGGAAAAAGAGGCTGG + Intergenic
1131625957 15:94120934-94120956 GAGGAGAAGGAAGAAGAGGAGGG - Intergenic
1131683143 15:94744895-94744917 AAGGAGAAGGGAAAGGAGGGAGG + Intergenic
1131690411 15:94820973-94820995 GAGGAGGAGGAAGAGGAGGAGGG + Intergenic
1131701627 15:94942985-94943007 GAGGAGGAGGAAAGGGAGGAGGG + Intergenic
1132075851 15:98819054-98819076 GTGGAGAAGGCAGATGGGGCAGG + Intronic
1132083290 15:98885393-98885415 GAGGAGAAGGAAAGGGAGAGGGG - Intronic
1132271855 15:100533220-100533242 GACGTGGAGGAAAATGAAGCAGG - Intronic
1132298983 15:100764918-100764940 GAGAAGGAGGAAAAGGAGGCCGG - Intergenic
1132433103 15:101776175-101776197 GAGGATGAGGAAAATGTCGCAGG - Intergenic
1132664144 16:1073988-1074010 CAGGAGAGGGAAACTGAGGCAGG - Intergenic
1133293204 16:4736333-4736355 AACTAGAAGGAAACTGAGGCAGG + Intronic
1133417387 16:5616893-5616915 GAGGGGGTGGAAAAAGAGGCAGG - Intergenic
1133460662 16:5983888-5983910 GAGGAGGAGGAGAACGAGGAGGG - Intergenic
1133673856 16:8050913-8050935 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1133819169 16:9221455-9221477 AAGGAGTGGGAAAATGAGACAGG - Intergenic
1133943339 16:10328519-10328541 GAGGGCTAGGAAAATGAGGCTGG + Intronic
1134012144 16:10862401-10862423 GAGGAGAAAAAAAATTATGCAGG + Intergenic
1134070062 16:11255384-11255406 GAGGAGGAGGAAGAGGAGGAAGG + Exonic
1134256135 16:12613191-12613213 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
1134328653 16:13230117-13230139 GAGGAGACAGAAAAGAAGGCAGG + Intronic
1134610268 16:15602637-15602659 GAGGAGAAAGAAAAGGAGGAGGG + Intronic
1134866583 16:17612562-17612584 GAGGGCTAGGAAAATAAGGCTGG - Intergenic
1134892584 16:17854062-17854084 AAGGAGATGGAAGATGAGGGAGG + Intergenic
1135469906 16:22721155-22721177 GAAGAGAAAAAAAATGTGGCCGG - Intergenic
1135582574 16:23641102-23641124 GAGGAGAAGGAAAAGGTGCCGGG - Exonic
1135703736 16:24656164-24656186 AAAGAAAAGAAAAATGAGGCCGG + Intergenic
1135828365 16:25750797-25750819 GCGGGGAAGGAAAATGAAGTAGG - Intronic
1135946492 16:26869486-26869508 GAGGGCTAGGAAAATGAGACTGG - Intergenic
1136077061 16:27824380-27824402 GAGGAGAAGGAAACCTGGGCAGG + Intronic
1136157345 16:28392020-28392042 GAGGAGGAGGACAATGAAGGCGG - Exonic
1136205741 16:28723261-28723283 GAGGAGGAGGACAATGAAGGCGG + Exonic
1136428320 16:30183657-30183679 GAGGAGGAGGAAGAGGAGGAAGG - Exonic
1136464317 16:30431548-30431570 AAAGATAAGGAAACTGAGGCCGG + Intergenic
1136574498 16:31115517-31115539 GGGGGGAAAGAAAAGGAGGCTGG - Intergenic
1136639333 16:31549407-31549429 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1136736602 16:32473156-32473178 CAGGGGAAGGAAAATGGGGCAGG - Intergenic
1137439689 16:48487494-48487516 GTTGAGAAGGAAAATCCGGCTGG - Intergenic
1137462453 16:48677842-48677864 GGGGAGCAGGAAACGGAGGCAGG - Intergenic
1137543679 16:49382810-49382832 GTGGAGAAGGAAGACGAGGGAGG - Intronic
1137821783 16:51452949-51452971 GAGGAGTAGGGAAATGATCCAGG - Intergenic
1137859320 16:51830454-51830476 GAGGAGGAGGAAGAGGAGGAGGG - Intergenic
1138126174 16:54440503-54440525 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG + Intronic
1138316336 16:56073319-56073341 GAGGAGAAGGAAAAAGGGAGAGG - Intergenic
1138483217 16:57317924-57317946 ACAGAGAAGGAAACTGAGGCTGG - Intergenic
1138553121 16:57757907-57757929 GATGGGAAGGAAACTAAGGCTGG - Intergenic
1139021054 16:62749897-62749919 AAGGAGGAGGAAGAAGAGGCAGG + Intergenic
1139025354 16:62810249-62810271 AAGGAGAGAGAAAAGGAGGCAGG - Intergenic
1139155591 16:64437917-64437939 GAGGGGAAGGAGAAAAAGGCCGG + Intergenic
1139413922 16:66790302-66790324 GAGGAGAAGGGAAAGGAGGGAGG + Intronic
1139612288 16:68067576-68067598 TAATAGAAAGAAAATGAGGCTGG - Intronic
1139811369 16:69621061-69621083 GAGGATCAGGAAAATGCTGCAGG - Intronic
1140067464 16:71623988-71624010 GAGTAGAAGGAAAAAGAAGAGGG - Intergenic
1140712385 16:77690645-77690667 GAGGTGACGGAACATGAGGGCGG - Intergenic
1140744507 16:77969299-77969321 GAGGGCTAGGAAAATGAGGCTGG - Intronic
1140903546 16:79391914-79391936 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1140962630 16:79931223-79931245 GAGGAGATGGAAGATGAGTCGGG - Intergenic
1141007136 16:80363136-80363158 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1141713983 16:85716520-85716542 GGGGAGAAGGAAGAGGAGGGAGG + Intronic
1141856222 16:86683103-86683125 GGGGAGAAGGAAAAGAAGGAAGG + Intergenic
1141924611 16:87159940-87159962 AAGGAGAAGGAGAAGGAGACAGG + Intronic
1141931886 16:87210740-87210762 GAGGAGAAAGAAAAAGAGAGAGG + Intronic
1142067268 16:88069879-88069901 GAGGAGGTGGAAGAGGAGGCAGG - Intronic
1142172779 16:88631575-88631597 GAGGAGGAGGAAGAGAAGGCGGG - Exonic
1142254184 16:89006127-89006149 GAGGGCAAGGAAGAAGAGGCAGG + Intergenic
1142289011 16:89184215-89184237 CACGGGAAGGAAACTGAGGCGGG - Intronic
1142399394 16:89851435-89851457 AAGGGGCAGGAGAATGAGGCTGG - Intronic
1203016466 16_KI270728v1_random:356421-356443 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1203034801 16_KI270728v1_random:629579-629601 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1142714260 17:1739332-1739354 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714281 17:1739422-1739444 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714331 17:1739645-1739667 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714395 17:1739915-1739937 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714438 17:1740095-1740117 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714522 17:1740455-1740477 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714791 17:1741580-1741602 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714811 17:1741670-1741692 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714834 17:1741760-1741782 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714887 17:1741983-1742005 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714899 17:1742028-1742050 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142795430 17:2303570-2303592 GAGGAGGAGGAGAGGGAGGCGGG + Intronic
1142881588 17:2886038-2886060 GAGCAGAAGGCAGATGCGGCAGG + Intronic
1143054937 17:4155774-4155796 GTGGGGAGGGAAAAGGAGGCAGG - Intronic
1143270030 17:5668597-5668619 GAGGAGAAGTAAGAGGAGGAGGG - Intergenic
1143364098 17:6394457-6394479 GGGGAGAAGGAAGATCAAGCTGG - Intronic
1143391265 17:6560654-6560676 GAGGAGGAGGAAGAGGAGGAGGG - Intergenic
1143391349 17:6561031-6561053 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391375 17:6561128-6561150 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143391467 17:6561436-6561458 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391473 17:6561468-6561490 GAGGAGGAGGAAGAGGAGGAGGG - Intergenic
1143601517 17:7949155-7949177 GAGGTGAGGGAAAGTCAGGCAGG + Exonic
1143891335 17:10104780-10104802 GTGGAGAAGGAAAATGTGGATGG - Intronic
1144168786 17:12638377-12638399 GGGGAGAAGGGAGATCAGGCTGG - Intergenic
1144410408 17:14995108-14995130 GAGGAGGAGGAAGAGGAGGAAGG - Intergenic
1144457432 17:15430607-15430629 GAGAAGAAGGGAAAGGAGGGAGG + Intergenic
1144620700 17:16816679-16816701 CAGGAGAAGGAAAAAGGGGAGGG + Intergenic
1144734529 17:17547643-17547665 GAGGAGGAGGAAGAGGAGGGAGG - Intronic
1144884942 17:18451468-18451490 CAGGAGAAGGAAAAAGGGGAGGG - Intergenic
1145026358 17:19470774-19470796 TGAGAGATGGAAAATGAGGCAGG - Intergenic
1145147279 17:20492909-20492931 CAGGAGAAGGAAAAAGGGGAGGG + Intergenic
1145291415 17:21549527-21549549 GGGGAGAAGGGAAAAGAGTCAGG + Intronic
1145940702 17:28742010-28742032 GAGGAGAAGCAATATCAGGGTGG - Exonic
1145994453 17:29097409-29097431 GAGGGGAAGGAGGATGGGGCAGG + Intronic
1146320963 17:31846092-31846114 GAGGAGAAGGAAGACCAGGTGGG - Intergenic
1146689591 17:34864058-34864080 GATGAGAAGGAAGAAGAGGAGGG - Intergenic
1146930197 17:36771618-36771640 CAGGTGGATGAAAATGAGGCTGG + Intergenic
1146948408 17:36889750-36889772 CAGGAGGAGGAAGATGAGGGTGG + Intergenic
1147047377 17:37763431-37763453 CTGGGGAAGGAAACTGAGGCTGG - Intergenic
1147366085 17:39960219-39960241 GAAAAGAAAGAAAAAGAGGCAGG + Intergenic
1147420824 17:40321429-40321451 GAGGAGGAGGAGGAAGAGGCAGG + Intronic
1147498817 17:40942570-40942592 GAGGAGGAGGAAGATGAAGGAGG - Intergenic
1147498868 17:40942866-40942888 GAGGAGGAGGAAGAGGAGGAAGG - Intergenic
1147838475 17:43352727-43352749 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
1147839414 17:43360392-43360414 GAGGGCTAGAAAAATGAGGCCGG - Intergenic
1148606379 17:48932386-48932408 GAGGATGAGTAGAATGAGGCAGG - Intronic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1149028472 17:52057311-52057333 GAGGAGGAGGGAAAAGAGGAAGG - Intronic
1149038389 17:52158932-52158954 GAGGAGGAGGAGGAGGAGGCTGG + Intronic
1149107184 17:52983528-52983550 GAGGAGAAGGATTATGGGGCAGG + Intergenic
1149114165 17:53071729-53071751 GAGAAGAAGAAAAAGGAGGGAGG + Intergenic
1149785795 17:59433889-59433911 GAGGAGAGGGGAAAGGAGGAGGG - Intergenic
1149821329 17:59780882-59780904 GAAGAAAAGAAAAATCAGGCTGG - Intronic
1150037694 17:61821476-61821498 AAAGAGAATGAAATTGAGGCAGG - Intronic
1150218906 17:63484899-63484921 GAGCAGCAGGAAGAGGAGGCTGG - Exonic
1150278042 17:63912149-63912171 GAGGAGGAGAAAAAAGAGGACGG - Intronic
1150279357 17:63920034-63920056 GAGGAGGAGAAAAAAGAGGAGGG - Intergenic
1150447716 17:65240369-65240391 CAGGAGAAAGAAAATGAAGCTGG - Intergenic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1151383570 17:73741756-73741778 GAGAAAAAGAAAAAGGAGGCAGG - Intergenic
1151429317 17:74051726-74051748 GAGGAACAGGAAAATGAGGCTGG + Intergenic
1151659225 17:75509875-75509897 GAGGAGCAGGACAATGTGACAGG + Intronic
1151783138 17:76260934-76260956 GAGGAGAAGGAGAATGGGAAAGG - Intergenic
1151814635 17:76465684-76465706 AATGAGAAGGAAAATAAGGAGGG - Intronic
1152019478 17:77772915-77772937 GAGGAAAAGGGAAGTGAGGGGGG - Intergenic
1152138844 17:78524734-78524756 GAGGAGGAGGAAAAAGACGAAGG + Intronic
1152269327 17:79314588-79314610 GTGGACAAAGAAAATGGGGCAGG + Intronic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1152494969 17:80664568-80664590 GAGGAGGTGGAAAGAGAGGCAGG - Intronic
1152940363 17:83168898-83168920 AAGGAGAAGGAAAATAATGTAGG - Intergenic
1153018589 18:606531-606553 GAGGACAAGGAAGATGGGGTGGG - Intronic
1153106704 18:1536423-1536445 TAGGAGAAAGAAAGTGAGGAAGG - Intergenic
1153155522 18:2145005-2145027 GAGGGCTAGGAAATTGAGGCTGG + Intergenic
1153185247 18:2478892-2478914 GAGGAGGAGGAAGAAGAGGGAGG + Intergenic
1153273342 18:3344587-3344609 GAGGAAAAGGAAAACTAGGCAGG + Intergenic
1153331306 18:3878460-3878482 GAGGAGGAGGAAAAGGAGGAAGG - Intronic
1153549131 18:6242386-6242408 GAGGAGAAGGATAATGGCGGTGG - Intronic
1153575535 18:6516535-6516557 GAGGAGGAGGAAGAGGAGGAGGG + Intronic
1153780108 18:8486965-8486987 GATGAGAAGAAGAAAGAGGCAGG - Intergenic
1153881781 18:9427520-9427542 GAGGAGAAGGAAGCAGAGACTGG - Intergenic
1153942544 18:9990484-9990506 GAGAAGACATAAAATGAGGCTGG - Intergenic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1153973779 18:10248848-10248870 GAGAATATGGAAAATGATGCAGG + Intergenic
1154108244 18:11543607-11543629 GAGGAGAAGGAATATGAATCTGG - Intergenic
1154299277 18:13178795-13178817 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1154478475 18:14791802-14791824 GACGGGAAGGAACAAGAGGCAGG + Intronic
1154479423 18:14804136-14804158 GACGGGAAGGAACAAGAGGCAGG + Intronic
1154480216 18:14815023-14815045 GACGGGAAGGAACAAGAGGCAGG + Intronic
1155064725 18:22258397-22258419 GAGGAGGAGGAAAAGGAGGAAGG - Intergenic
1155066625 18:22274016-22274038 GAGGAGGAGGAAGAGGAGGAGGG - Intergenic
1155151259 18:23124807-23124829 GAGGAGAAGGAAAATGCCCTTGG - Intergenic
1155277000 18:24198082-24198104 CAGTAGAAGGAAAATTTGGCTGG - Intronic
1155512711 18:26593758-26593780 GAGGAGAAGGACAAGGAGGGAGG + Intronic
1155512724 18:26593816-26593838 GAGGAGAAGGACAAGGAGGGAGG + Intronic
1155646759 18:28087937-28087959 GGGGAGGAAAAAAATGAGGCGGG - Intronic
1155759054 18:29541369-29541391 GAGGAGAGGGAGAAAGAGGAAGG - Intergenic
1156079397 18:33315691-33315713 GGGGGCTAGGAAAATGAGGCTGG + Intronic
1156368508 18:36451601-36451623 GAGGAGAAGGAAGAGGAGGGAGG - Intronic
1156390420 18:36645084-36645106 GAGGAAAAGAAGACTGAGGCTGG + Intronic
1156580355 18:38367875-38367897 GAGAACAAGGAACATAAGGCAGG + Intergenic
1156791742 18:40984020-40984042 GAGGAGGAGGAAGAAGAGGAAGG - Intergenic
1157140529 18:45101510-45101532 GAGATTAAGGTAAATGAGGCTGG - Intergenic
1157276069 18:46311896-46311918 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1157308070 18:46531406-46531428 GATGAGGGGGAAAATGAGGGGGG - Intronic
1157407902 18:47438816-47438838 CAGGAGCAGGAGAGTGAGGCAGG - Intergenic
1157408077 18:47440526-47440548 GAGAAGAAGGAGAGTGAGGGAGG + Intergenic
1157680129 18:49598546-49598568 GAGGAGAAGGAGAAAGAAGCAGG - Exonic
1157748437 18:50157567-50157589 GGGGAGAAGAGAAATGTGGCTGG - Intronic
1157763301 18:50280702-50280724 AAGGAGAAGAAAAATAAGGGGGG - Intronic
1158106646 18:53892446-53892468 TAAGAAAAGGAAAATTAGGCTGG + Intergenic
1158146962 18:54325155-54325177 CAGGATAAGGGAAATGAGGGAGG - Intronic
1158279601 18:55808508-55808530 AAGGAGAAGGACTAGGAGGCTGG - Intergenic
1158903912 18:61992435-61992457 AATGAGAAGGAAAATGGGGAGGG + Intergenic
1158963469 18:62604811-62604833 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1159115316 18:64106737-64106759 AAGGAGCAGAAAAATGACGCAGG + Intergenic
1159116191 18:64115423-64115445 AAGAAGGAGGAAAATGAGGTAGG + Intergenic
1159318607 18:66814879-66814901 GAGGGTAAGGAAAATGAGGAAGG + Intergenic
1159388334 18:67756483-67756505 GAGGGCTAGGAAAATGATGCTGG + Intergenic
1159554637 18:69932603-69932625 GCGCAAAAGCAAAATGAGGCTGG - Intronic
1159949459 18:74471477-74471499 GAGGAGAAGGAGCAAGAGGCAGG - Intergenic
1160020983 18:75181069-75181091 GAAGATAAGGAAGATAAGGCTGG - Intergenic
1160174569 18:76582189-76582211 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1160371595 18:78376737-78376759 GAAGAGAAGGCACATGAGGAAGG - Intergenic
1160525853 18:79535731-79535753 GAGGAGATGGAAAGTCAGTCAGG - Intergenic
1160589533 18:79935490-79935512 GAGGAAAAGGAAAATGTTGCTGG - Intronic
1160804751 19:987600-987622 GCTGAGAGGGAAACTGAGGCAGG + Intronic
1160900231 19:1424305-1424327 GAGGAGGAGGAAGAGGAGGAGGG - Intronic
1160983431 19:1827035-1827057 GAGGAGGAGGAGGATGGGGCGGG + Exonic
1161100528 19:2419001-2419023 GAGGGGAAGGAAAGGGAGGGAGG - Intronic
1161100569 19:2419107-2419129 GAAGAGAAGGAAAGGGAGGGAGG - Intronic
1161121962 19:2532528-2532550 GAGGAGAGAGAGAATGAAGCAGG + Intronic
1161283717 19:3458515-3458537 GAGGGAAGGGAAACTGAGGCAGG + Intronic
1161370579 19:3908766-3908788 GAGGAGAAGGAAGAGGGGGGAGG - Intronic
1161467887 19:4442284-4442306 GAGGAGGAGGAAGAGGAGGAGGG + Exonic
1161469044 19:4447304-4447326 GAAGAGGAGGAAAAGGATGCAGG + Intronic
1161635122 19:5383665-5383687 GAGGAGGAGGAAAAAGAAGAAGG - Intergenic
1161842945 19:6693700-6693722 GAGGAGAAGGATATTGAGGGTGG + Intronic
1161909735 19:7184259-7184281 GAGGAGAAGGAACGTGGGGTTGG - Intronic
1161955213 19:7490152-7490174 AAGGAAAAGGACATTGAGGCCGG - Intronic
1162211875 19:9098421-9098443 GTACAGAAGGAAGATGAGGCCGG - Intergenic
1162297440 19:9823003-9823025 ACGAAGAGGGAAAATGAGGCCGG + Intronic
1162391469 19:10392817-10392839 TTGGATAAGGAAACTGAGGCTGG + Intronic
1162541665 19:11300255-11300277 GGGGACATGGCAAATGAGGCAGG + Intronic
1162615195 19:11794203-11794225 GAGGGCTAGGAAAGTGAGGCTGG + Intergenic
1162806669 19:13140776-13140798 GAAGAGAAGGAAAAAGCAGCAGG - Exonic
1162864948 19:13538573-13538595 GAGGGGAAGAAAACTGGGGCGGG + Intronic
1162903385 19:13808802-13808824 GAGGGAAAGGAAGCTGAGGCTGG - Intronic
1162991757 19:14307416-14307438 GGGGAGAAGAAAAATGAGACAGG - Intergenic
1162996649 19:14340046-14340068 GGGGAGAAGGAGAGTGAGGAAGG - Intergenic
1163164264 19:15484462-15484484 GAGGAGAAGGAACTTGGGGCAGG + Intronic
1163552632 19:17974099-17974121 GATGATGAGGAAGATGAGGCCGG + Exonic
1163630443 19:18415575-18415597 GAGGAGGAGGAAGAGGAGGAGGG + Intergenic
1163667251 19:18609090-18609112 GAGGAGAGGGAAGAAGAGGAGGG - Intronic
1163703075 19:18796240-18796262 GAGTAAAAGGAGAATGGGGCTGG - Intergenic
1163848834 19:19652295-19652317 GGAGAGAAGGAAGCTGAGGCTGG - Intronic
1164234935 19:23323582-23323604 GAAAAGAAGGAAAAGGAGGATGG - Intronic
1164250190 19:23469049-23469071 GAGAAGAAGGAAAAAGAGGATGG - Intergenic
1164250274 19:23469629-23469651 GAGGAGATGGAGAAGGAGGGGGG - Intergenic
1164292383 19:23879995-23880017 GAGAAGAAGGGAAAGGAGGAGGG + Intergenic
1164441690 19:28284445-28284467 GAGGGGGAGGAAAAGGAGGGTGG + Intergenic
1164529783 19:29039628-29039650 GGGGAGTGGGAAAATGAGACAGG - Intergenic
1164592624 19:29514554-29514576 AAGGAGAGGGAAGATGAGGAAGG + Intergenic
1164629691 19:29754013-29754035 GAGGATGAGGAAACTGAAGCAGG - Intergenic
1164781431 19:30896705-30896727 GGGGGGAGGGGAAATGAGGCAGG - Intergenic
1164868667 19:31625731-31625753 GAGGAAGAGGAAAAGGAGGAGGG - Intergenic
1164972248 19:32542560-32542582 GAGGAGAAAGAGAATGAAGTAGG + Intergenic
1165050290 19:33137089-33137111 AAGAAGAAAGAAAATGAGCCAGG - Intronic
1165066308 19:33230845-33230867 GAGAACAGGGAAAATGAGGCAGG - Intergenic
1165348302 19:35262579-35262601 CAGGAGGAGGAAGATGAGGAAGG - Exonic
1165348913 19:35266318-35266340 CAGGAGAAGGGGGATGAGGCAGG - Intronic
1165610712 19:37149820-37149842 GAGGAAAAGGTCTATGAGGCTGG + Exonic
1166304209 19:41928447-41928469 GAGGAGAAGGCGCAGGAGGCAGG - Intronic
1166335878 19:42106863-42106885 GAGGAGAAGGAAAATTAGCCAGG + Intronic
1166498065 19:43319497-43319519 GAGGGCTGGGAAAATGAGGCTGG - Intergenic
1166503387 19:43356678-43356700 GCAGACAAGGAAACTGAGGCAGG - Intronic
1166507067 19:43378083-43378105 GCAGACAAGGAAACTGAGGCAGG + Intergenic
1166536664 19:43578933-43578955 AAAGAGAAGGAAAATGTGGGAGG + Intronic
1166652131 19:44582648-44582670 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1166986598 19:46663797-46663819 AAAGAGAATGCAAATGAGGCCGG + Intergenic
1167384393 19:49155546-49155568 GAGGAGGAGGAGCAGGAGGCAGG - Intergenic
1167417990 19:49386969-49386991 GAGCAGAAGGGAAGGGAGGCGGG + Intergenic
1167511317 19:49896728-49896750 GAGGAAGAGGGAAAAGAGGCCGG - Intronic
1167621341 19:50562697-50562719 GAGGAGGAAGAGAGTGAGGCAGG - Intronic
1167625529 19:50585942-50585964 CAGCAGAAAGAAAATCAGGCTGG + Intergenic
1167686496 19:50960009-50960031 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1167726094 19:51213830-51213852 AAGAAAAAGAAAAATGAGGCTGG - Intergenic
1167775639 19:51552998-51553020 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1168058581 19:53877732-53877754 GAGGAGAATGAAAGTGAAGGAGG + Intergenic
1168103540 19:54153521-54153543 CAGGAGAAGGAAAATGAGACAGG - Intronic
1168181621 19:54665875-54665897 GAGGAGGAGGAAGAGGAGGAGGG - Exonic
1168238776 19:55078970-55078992 GGGGAGAAAGAGAATGAGCCTGG - Intronic
1168267884 19:55232143-55232165 GAGGAGGAGGAAGACGAGGAGGG - Exonic
1168406378 19:56112651-56112673 GAGGGGAAGGAATAAGAGACTGG - Intronic
1168484753 19:56751464-56751486 GAGAAGAAGGAAAGTGATGTGGG + Intergenic
1168675908 19:58277983-58278005 GAGGGCTAGGAAAATGAGGCTGG + Intronic
1168691763 19:58381678-58381700 GAGAAGAAAGAAAATTAGCCGGG - Intergenic
1202711457 1_KI270714v1_random:21530-21552 ACAGAGAAGGAAACTGAGGCTGG + Intergenic
925115553 2:1375484-1375506 GGGGAGAAGGAAAAAGAGGGAGG + Intronic
925162132 2:1692932-1692954 GTGGAGCAGGAAAGTGAGGCTGG - Intronic
925273635 2:2633472-2633494 GAGGAGAAGGAACAGGAAACGGG - Intergenic
925395896 2:3533524-3533546 CAGGAGAAGGAAGGTGAGCCAGG + Intronic
925402563 2:3586022-3586044 GAGGAGAGGAAAAAGGAGGAGGG + Intergenic
925694800 2:6565158-6565180 TTGGAGAAGGAAAATTTGGCAGG + Intergenic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
925850301 2:8075290-8075312 TAAGAAAAGGAAGATGAGGCCGG + Intergenic
925978857 2:9160977-9160999 GGGGAGTAGGGAAGTGAGGCTGG - Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926626116 2:15091361-15091383 GAGAAGGAGGAAAAAGAGGAGGG - Intergenic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
927146736 2:20171116-20171138 GAGCAGAAGGAAAAGAGGGCAGG - Intergenic
927212387 2:20646765-20646787 GTGGAGGAGGAAGGTGAGGCTGG + Intronic
927287522 2:21371794-21371816 GAGGAGTGGGAATATGAGCCGGG + Intergenic
927353078 2:22141597-22141619 GAGGAGAAGGAAAAGGAAACAGG + Intergenic
927557602 2:24047171-24047193 GAGGATGAGGAGAATGGGGCGGG - Intronic
927973029 2:27317570-27317592 GCAGAGAAGGAAACTGAGGCAGG - Intronic
928325889 2:30319195-30319217 GAGGAGGAGGAGGAGGAGGCTGG + Intronic
928452896 2:31394157-31394179 AAAGAGAAGGAAAATGATGTAGG - Intronic
928700226 2:33891520-33891542 GAGGATAAGGAAAATAAGTATGG + Intergenic
928781927 2:34833779-34833801 GAGGAGGAGGAATAGGAGGAAGG + Intergenic
928807615 2:35179693-35179715 GAGGAGTAGTAAAATAAGGTTGG - Intergenic
929015007 2:37485221-37485243 GAGGAGAAGGAATATGGAGGAGG - Intergenic
929154424 2:38776718-38776740 GAGGGCTAGGAAAATGAGGCTGG + Intronic
929296309 2:40251403-40251425 GAAGAGCAGGAAAAGGTGGCAGG + Intronic
929392101 2:41481622-41481644 CAGGGGAAAGAGAATGAGGCAGG + Intergenic
929853916 2:45619584-45619606 GAGGAGGAGGAAGAAGAGGAGGG + Intergenic
929950497 2:46406316-46406338 GCAGAGAAGGAAACTGAGTCAGG - Intergenic
929960656 2:46493922-46493944 TGGGAGCAGGAAAATGAGGCGGG + Intronic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
930541287 2:52710152-52710174 GAGAGGAAGGAAGTTGAGGCAGG - Intergenic
930773622 2:55151751-55151773 GAGTAGAAGGAAAGTTGGGCAGG + Intergenic
931415847 2:62079541-62079563 GAGGGCAAGGAAAATGAGGCTGG - Intronic
931512848 2:63019776-63019798 GAGGAGAAGGGAAAGGGGGAGGG + Intronic
931693242 2:64852955-64852977 GAGGAGGAAGAAAAAGAGGAAGG + Intergenic
931781141 2:65580166-65580188 GTGGAGAAAGAAAAGGAGGCAGG - Intergenic
931785052 2:65611046-65611068 GAGGCAAAGGGAAGTGAGGCTGG - Intergenic
931814372 2:65886218-65886240 GAGCAGCAAGAAAGTGAGGCTGG - Intergenic
931820189 2:65943739-65943761 GGGGAGAGGGGACATGAGGCTGG + Intergenic
932143216 2:69297486-69297508 AAGGAGAAGGAAAATGTGTGTGG - Intergenic
932511476 2:72297345-72297367 GAGGAACAGGAAAATGAGGAGGG - Intronic
932752031 2:74377371-74377393 GAGGGGAAGGAGAAAGAGGAGGG - Intronic
932989946 2:76774608-76774630 AAGGAGGAGGAACATGAGGAAGG + Intronic
933196043 2:79391270-79391292 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
933275881 2:80283881-80283903 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
933289894 2:80426424-80426446 GAGGAGAAGGGAAAGCAGGCAGG - Intronic
933441103 2:82315394-82315416 GAGGAGAAGGAAGAGGGGGAGGG - Intergenic
933687680 2:85156371-85156393 GAGGAAAAGGAAGCTGAAGCTGG - Intronic
933726693 2:85431110-85431132 AAGGAGGAGGAAATGGAGGCTGG + Intronic
933752938 2:85614883-85614905 GAGGGTTAGGAAAATGAGGCTGG - Intronic
933792042 2:85890596-85890618 GAGGGCTAGAAAAATGAGGCTGG - Intergenic
934138478 2:89020610-89020632 GGGCAGAAGGGAAATGAGGGAGG - Intergenic
934144563 2:89078709-89078731 GAGCAGAAGGGAAATGAGGGAGG - Intergenic
934164211 2:89279685-89279707 GAGAAGGGGGAAAGTGAGGCAGG + Intergenic
934187756 2:89762273-89762295 CAGGGGAAGGAAAATGGGGCAGG - Intergenic
934203063 2:89902839-89902861 GAGAAGGGGGAAAGTGAGGCAGG - Intergenic
934224689 2:90121840-90121862 GAGCAGAAGGGAAATGAGGGAGG + Intergenic
934230766 2:90179943-90179965 GGGCAGAAGGGAAATGAGGGAGG + Intergenic
934290475 2:91686692-91686714 GTGGAGAAGGAAACCAAGGCCGG - Intergenic
934308861 2:91845675-91845697 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
934725148 2:96611984-96612006 GGGGAGAAAGAAAATGAGCAGGG + Intronic
935051487 2:99528734-99528756 GAGGAGAAAGGAGATGAGGGAGG - Intergenic
935056010 2:99567564-99567586 GAGGAGACTGAATATGACGCCGG + Intronic
935209041 2:100922711-100922733 CAAGAGAAAGAAAATGAGCCTGG - Intronic
935446431 2:103161445-103161467 GAGGAGAAGGAAAATATGGAGGG + Intergenic
935803398 2:106722684-106722706 GAGGAGATGGAAGGGGAGGCAGG + Intergenic
935848989 2:107198310-107198332 GAGGAGGAAGAAAAAGAGGGAGG + Intergenic
936122497 2:109758941-109758963 GAGGGGAAGAAAAAAGAGGAGGG + Intergenic
936222196 2:110612531-110612553 GAGGGGAAGAAAAAAGAGGAGGG - Intergenic
936395578 2:112125697-112125719 GAGGAGAAGGAAAGGAAGGAAGG + Intergenic
937110778 2:119365954-119365976 GAAGAGTAGAAAGATGAGGCTGG - Intronic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937490222 2:122359444-122359466 GAGGAGGAGGAAGAGGAGGAGGG - Intergenic
937528390 2:122798986-122799008 GAGGGGAAGGAGAAAGAGGAGGG - Intergenic
937600642 2:123727341-123727363 GAGGAGGAAGAAAATGAGATTGG + Intergenic
937686802 2:124706816-124706838 GAGGAGGAGGAAGAGGAGGAGGG + Intronic
937709979 2:124969407-124969429 AGGAAGAAGGAAAATAAGGCAGG - Intergenic
937988172 2:127647937-127647959 GAGGAGAGGTAAAAGGAGGGAGG - Intronic
938397949 2:130964322-130964344 GAGGAGAAGGAAAGGCAGGAGGG - Intronic
939040576 2:137184416-137184438 GAGGAGATTGAAAATAAGGGAGG + Intronic
939370053 2:141287234-141287256 GAGGAGAATGAGAATGAGAATGG - Intronic
939831571 2:147078805-147078827 GTGGAGAGGGAAAATGAAGTTGG + Intergenic
939997830 2:148936951-148936973 GAGGAGGAGGAAAAGGGAGCAGG - Intronic
940383804 2:153047014-153047036 GAGGAGTGGGTAAATGAGCCTGG - Intergenic
940696406 2:156984730-156984752 GAGGAGAAGGAAGGGGAGGAGGG + Intergenic
940703966 2:157080842-157080864 GAGGTAAAGAGAAATGAGGCTGG + Intergenic
941041922 2:160632936-160632958 CAGGAGAAGGGAGATGAGACGGG + Intergenic
941151839 2:161924105-161924127 GAGGAGATAGAATATGAGTCTGG - Intronic
941228812 2:162883163-162883185 AAGGAGAAGGAAAGTGATGGTGG + Intergenic
941444546 2:165584294-165584316 GAGGGCTAGAAAAATGAGGCTGG - Intronic
941609428 2:167642693-167642715 TATGAGAAGAAAAATAAGGCAGG - Intergenic
941684768 2:168437120-168437142 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
941691801 2:168507843-168507865 GAGAAGAAAGAGAATGAGGAAGG - Intronic
941753530 2:169160465-169160487 GAGGAGAAGGAAGAAGAAGAAGG + Intronic
941800709 2:169656512-169656534 GAGGAGGAGGAGAAGGAGACAGG + Intronic
942131568 2:172885281-172885303 AGGGAGGAGGAAAGTGAGGCAGG - Intronic
942131573 2:172885301-172885323 AGGGAGGAGGAAAGTGAGGCAGG - Intronic
942350781 2:175050702-175050724 GAGGAGGAGGAAGAGGAGGGTGG + Intergenic
942502572 2:176607094-176607116 AAGGAGAAGGAAGAGGAGGTGGG + Intergenic
942528993 2:176888057-176888079 GAGGAGCTGAAAACTGAGGCAGG + Intergenic
942589513 2:177527019-177527041 GAGGACAAGGATACTGAGGCAGG - Intronic
942909523 2:181226383-181226405 GAGAAGGTGGAAAAGGAGGCAGG - Intergenic
943278271 2:185896885-185896907 GAGGAGAAGGAAGAAGAGGAGGG + Intergenic
943548175 2:189307599-189307621 GAGGGCTAGGAAAATGAGGATGG + Intergenic
943733184 2:191325039-191325061 GAAGAGAAGGAAAAGGAGAAAGG - Intronic
943997554 2:194789430-194789452 GAGGGCTAGGAAAAGGAGGCTGG - Intergenic
944037219 2:195309388-195309410 GAAGAGGAGGAAAAGGAGGAGGG - Intergenic
944155266 2:196600947-196600969 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
944388759 2:199194931-199194953 GAGGAGGAGGAGAATGAGCAGGG - Intergenic
944527592 2:200635777-200635799 GAGAGTAAGGGAAATGAGGCAGG + Intronic
944683341 2:202096571-202096593 GCAGAGAGGGAAAGTGAGGCTGG + Intronic
944691389 2:202161640-202161662 GAGGTGAAGCTAAATTAGGCTGG - Intronic
944811801 2:203334235-203334257 GAAGAAAAAGTAAATGAGGCTGG - Intronic
945073697 2:206015977-206015999 GTGCAGAAGGAAAATGTGGGTGG + Intronic
945225771 2:207530139-207530161 GAGGAGCAGGAGGAGGAGGCAGG + Intronic
945257335 2:207813493-207813515 GAGGAGAAGGAGGAGGAGGACGG + Intergenic
945890531 2:215426014-215426036 GAGGAGAAATAAAATGTGGAAGG - Intronic
946004067 2:216507926-216507948 GCAGATAAGGAGAATGAGGCTGG - Intronic
946080029 2:217109893-217109915 AAGGAGAATGAAGAGGAGGCTGG + Intergenic
946148809 2:217750326-217750348 GAGGAGGAGGAAGAAGAGGGGGG + Intronic
946225457 2:218261928-218261950 GAGGAGAGGGAAGAGGAGTCTGG - Intronic
946243267 2:218369780-218369802 AAGAAAAAGGAAATTGAGGCTGG - Intergenic
946382091 2:219355648-219355670 GAGGAGGAGAAAAATTAGGATGG - Intergenic
946402515 2:219475978-219476000 GAGGAGAAGTAGGATGAGTCAGG - Intronic
946424841 2:219588583-219588605 GAGGGCGAAGAAAATGAGGCTGG - Intergenic
946463663 2:219892192-219892214 AAGAGGAAGGAAAATGAGGAGGG + Intergenic
946539249 2:220665804-220665826 GAGGAGAGGGATAAAGAGGTTGG - Intergenic
946751849 2:222899978-222900000 GAGGGCTAGGAAAATGAGGCTGG - Intronic
946857670 2:223968899-223968921 GAGGAGGAGGAAAAGGGGGATGG - Intergenic
947190952 2:227504085-227504107 GAGGAGGAGGAAGAGGAGGAGGG + Intronic
947251775 2:228114763-228114785 TAGGAGAAGAAAAATGAGAATGG - Intronic
947361008 2:229345415-229345437 GAGAATAGGGAAAATGAGGCAGG - Intergenic
947591383 2:231388132-231388154 ACAGAGAAGGAAACTGAGGCAGG - Intergenic
947833381 2:233158016-233158038 GAGGAGAAGGAAGAAGAGAGAGG + Intronic
947894780 2:233659622-233659644 GAGGAGGTGGAAAGGGAGGCAGG + Intronic
947930578 2:233961598-233961620 GAAAAGAAGAAAAAAGAGGCCGG - Intronic
947946247 2:234105383-234105405 CTGGAGAAGGTAAAGGAGGCAGG + Intergenic
947979080 2:234393514-234393536 GAGCAGAAGGTAAATGCTGCAGG - Intergenic
948295135 2:236855157-236855179 TGGGAGAAGGAGGATGAGGCAGG - Intergenic
948329021 2:237150562-237150584 GAGGAGAATGGAAGAGAGGCTGG + Intergenic
948494487 2:238338078-238338100 GAGGAGGAGGAAGAGGAGGAGGG + Intronic
948568443 2:238901270-238901292 GAGCAAAAGGCAAAGGAGGCCGG - Intronic
948644216 2:239393609-239393631 GAGGAGGAGGAAGGGGAGGCTGG - Intronic
948781315 2:240323571-240323593 GAGGTGGAGGAAAAGGAGTCTGG + Intergenic
1168752340 20:291695-291717 AAGGAGACTGAAAAGGAGGCAGG - Intergenic
1168854769 20:1000991-1001013 AAGGGGAAGGAAAATGAGAGAGG - Intronic
1169171006 20:3465356-3465378 GAGGAGGAGGAAAATGCAGAAGG - Intergenic
1169285352 20:4303056-4303078 GGGGAGTGGGAAAGTGAGGCAGG + Intergenic
1169561215 20:6802838-6802860 GAGGAGAAGGAGAAGGAGAACGG - Intergenic
1169636113 20:7693762-7693784 GGAGAGAAGGAAAAGGAGGAGGG - Intergenic
1169792058 20:9421631-9421653 GAGGAGAACCAAAAGGAGGCAGG - Intronic
1169828027 20:9791038-9791060 AAGGAGAAGGCAAATGAAACAGG - Intronic
1169934273 20:10866135-10866157 GAGGGGCAGGAAAGTGAGACAGG + Intergenic
1170311474 20:14997151-14997173 AAGGAGAAGGAAAAGGAGTGGGG + Intronic
1170419327 20:16176933-16176955 GAGGAGGAGGAAGAAGAGGAGGG - Intergenic
1170421561 20:16198581-16198603 GAGGAGTAGGGAAATGAAGAGGG - Intergenic
1170456862 20:16541729-16541751 GAAAAGAAGGAGACTGAGGCAGG + Intronic
1170529913 20:17281004-17281026 AAGGAGAAGGCAAATATGGCGGG - Intronic
1170555801 20:17513765-17513787 GTGGAGTGGGAAAGTGAGGCAGG + Intronic
1170602946 20:17855606-17855628 GAAGAAATGGAAAATCAGGCTGG + Intergenic
1170618912 20:17977820-17977842 GAGGGCTAGGAAAGTGAGGCTGG - Intronic
1170654389 20:18272654-18272676 GAAGATAAGGACAATGAGACAGG - Intergenic
1170723794 20:18907731-18907753 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1170793130 20:19524170-19524192 GAGGAGCAGGGAAGTGAGTCAGG - Intronic
1170821357 20:19758207-19758229 GAGGAGGAGGAAGAGGAGGAAGG - Intergenic
1170875766 20:20248563-20248585 GAGGAGAAGGAACAGGAGGCAGG + Intronic
1171028092 20:21651274-21651296 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1171116812 20:22531831-22531853 GAGGAGAGAGAAAAGGAGGAAGG + Intergenic
1171562282 20:26136444-26136466 TGGGAGGAGGAAAATGAGGGAGG + Intergenic
1171941186 20:31331312-31331334 GAGGAGCAGGAGAAGGAGGAGGG + Intergenic
1172046166 20:32081862-32081884 GTGGGGCAGGAAAATGAGCCTGG + Intronic
1172548999 20:35784346-35784368 GAGGGGAAAAAAAATGTGGCCGG - Intronic
1173071651 20:39774069-39774091 CATGAGAAGGAAAATAAGGCAGG + Intergenic
1173076808 20:39827166-39827188 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1173365360 20:42380193-42380215 TGGGATAAGGAAACTGAGGCAGG - Intronic
1173377158 20:42496230-42496252 GAGGAGGTGGAAGGTGAGGCAGG + Intronic
1173626576 20:44477155-44477177 GGTGCGATGGAAAATGAGGCTGG + Intronic
1173742429 20:45410381-45410403 GAGGAGAGAGAAGATGAGGTTGG + Exonic
1174286134 20:49474902-49474924 GAGGGGAGGGAACATGAGACAGG + Intronic
1174287046 20:49481182-49481204 GAGGAGGAGGAGGAGGAGGCAGG - Intronic
1174775681 20:53341165-53341187 AAGGACAAGCAAACTGAGGCAGG - Intronic
1174775821 20:53342198-53342220 CTGGAGCAGGAAAATGACGCAGG - Intronic
1174820796 20:53725069-53725091 GAGGAGATGAAAAATATGGCCGG - Intergenic
1174952324 20:55055876-55055898 GAGGAGATGGAAAGGCAGGCAGG - Intergenic
1175286792 20:57841899-57841921 GAAGAGAAAGCAAATGAGGCAGG - Intergenic
1175293733 20:57894868-57894890 TGGGAGAAAGAAAATGAGGGAGG + Intergenic
1175298861 20:57928689-57928711 GAGGAGGAGGAAGAAGAGGAGGG - Intergenic
1175609092 20:60335223-60335245 GAGGAGAAGAAAGAGGGGGCGGG - Intergenic
1175661423 20:60816275-60816297 GAGGAGGAGGAAAAAGAAGAAGG - Intergenic
1175848784 20:62075426-62075448 GAGGAGAGAAGAAATGAGGCAGG + Intergenic
1176037867 20:63049156-63049178 GAGGAGGAGGAAGAGGAGGGAGG - Intergenic
1176104903 20:63381330-63381352 GAGGAGAAAGAAAAGTAGGGAGG + Intergenic
1176290836 21:5043815-5043837 GAGGAGGAGGAAGAGGAGGAGGG - Intergenic
1176800326 21:13421266-13421288 GACGGGAAGGAACAAGAGGCAGG - Intergenic
1177062131 21:16389101-16389123 GAGGGCTAGGGAAATGAGGCTGG - Intergenic
1178038756 21:28615337-28615359 GAAGAGAAGGAAGAGGAGGAGGG - Intergenic
1178077489 21:29025041-29025063 GAGGAGAGGGAAGGTGTGGCAGG + Intronic
1178147309 21:29755176-29755198 GAGGAGAAAGAAAGTGTGCCTGG + Intronic
1178287751 21:31339355-31339377 CAGGAGGAGGAAGAGGAGGCTGG - Exonic
1178432321 21:32527333-32527355 GAAAAGAAAGAAAATGATGCAGG + Intergenic
1178496554 21:33090859-33090881 CAGGGGAAGGAAGATAAGGCAGG + Intergenic
1178505256 21:33157401-33157423 GAGGAGGAGGAGAAAGAGGGAGG - Intergenic
1178505261 21:33157420-33157442 GAGGAGGAGGAGAAAGAGGGAGG - Intergenic
1179133679 21:38661022-38661044 GAGGAGGAGGAAGAGGAGGAGGG + Intronic
1179141347 21:38728133-38728155 GTAGAGAAGGAAAGTGAGACAGG - Intergenic
1179164648 21:38925922-38925944 GATCAGAAGGAAGATGAGCCTGG + Intergenic
1179236725 21:39554093-39554115 GAGCAGAAGGAAGAGGAGGAGGG - Intergenic
1179262086 21:39766200-39766222 AAGGAGAAAGAGAATGAAGCAGG - Intronic
1179412466 21:41172744-41172766 GAGGAAAGGGAAGATGAGGGAGG - Intronic
1179866419 21:44219826-44219848 GAGGAGGAGGAAGAGGAGGAGGG + Intergenic
1179902405 21:44401012-44401034 GAGGAGAAAGGGAAGGAGGCAGG - Intronic
1180210986 21:46295476-46295498 GAGGAGGAGGAAGAGGAGGGAGG - Intronic
1180285913 22:10744182-10744204 GAGGAGAAGTTAGATAAGGCTGG + Intergenic
1180301617 22:11040954-11040976 GAGGAGAAGGAGGAGGAGGAAGG + Intergenic
1180535944 22:16392763-16392785 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1181314652 22:21963567-21963589 CAGGAGAAGGCAAATGAGGAAGG - Intronic
1181473274 22:23153665-23153687 AAGTGGAAGGAAAGTGAGGCTGG - Intronic
1181776101 22:25161113-25161135 AAGGAGAAGGAAAGTTAGGAAGG - Intronic
1181817287 22:25448110-25448132 GAGAAGAAGGAAAGCGGGGCCGG + Intergenic
1182185833 22:28401171-28401193 GAGGAGAAGGAAAAGGAGGGGGG + Intronic
1182733464 22:32513620-32513642 GCTGAGAAGGAAGATGAGGCAGG + Exonic
1182744266 22:32593605-32593627 GAGGAGGAGGAGAAGGAGGGAGG + Intronic
1182806159 22:33072282-33072304 GAGGAGAAGGAGGAGGAGGTGGG + Intergenic
1182825151 22:33258503-33258525 GAGGACTAGGAACATGAGGCTGG + Intronic
1182922007 22:34088843-34088865 GAGTGGAAGGAAAATGTGGTGGG - Intergenic
1183111915 22:35656438-35656460 GCGGAGAGAGAAAGTGAGGCTGG + Exonic
1183301489 22:37061178-37061200 GAGGTGGATGAAGATGAGGCAGG - Intronic
1183326245 22:37196298-37196320 AACAAGAAGGAAACTGAGGCAGG - Intronic
1183615707 22:38944075-38944097 GAGGAGAAGGAGAGGGAGGAAGG - Intergenic
1183868831 22:40725226-40725248 AAGGAGAAGGAAGATGAGGGTGG - Intergenic
1184374535 22:44103403-44103425 GAGGGGAAGGGAGGTGAGGCAGG - Intronic
1184449793 22:44576077-44576099 GAGGAGGAGGAAGAGGAGGAGGG + Intergenic
1184547792 22:45183910-45183932 GAGGAGGAGGAAGACGGGGCAGG + Intronic
1184590222 22:45477060-45477082 GAGGAGGAGGAGGATGCGGCAGG - Intergenic
1184984030 22:48117284-48117306 AAGGAGAAGGGAAATGAAGGAGG + Intergenic
949194886 3:1293237-1293259 AAGGAGAAAGAAAATGTGGAAGG - Intronic
949684813 3:6556725-6556747 GAGGAGATAGAAAGGGAGGCAGG - Intergenic
950159612 3:10750272-10750294 GAGGTGAGGGAACATGAGGATGG - Intergenic
950401112 3:12769488-12769510 GAGGGGTAATAAAATGAGGCTGG + Intergenic
950405811 3:12803843-12803865 GAGGAGTAGGGAAGTGAGGCAGG + Intronic
950448411 3:13051766-13051788 TAGCAGAGGGAAACTGAGGCAGG - Intronic
950475267 3:13210803-13210825 GGGGAGAAGGGGAAGGAGGCAGG + Intergenic
950582024 3:13868638-13868660 GAGGAGAAAGAAAAAAAGGAGGG + Intronic
950729987 3:14948243-14948265 GAGGAGGAGGATAAGGAGGAAGG - Intronic
951033010 3:17903788-17903810 GAGGAGGAGGACAAAGAGGAAGG - Intronic
952046488 3:29327486-29327508 AAGGAGGAGGAAAAGGAGGAAGG - Intronic
952107584 3:30087733-30087755 GAGGAGAAGGAGGAGGAGGGAGG - Intergenic
952354193 3:32570128-32570150 GAGGAGGAGGAACCTGAGGGAGG + Intronic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
952500171 3:33954276-33954298 GAGGAGAAAGAGATTGGGGCAGG + Intergenic
952715369 3:36474521-36474543 GAGGAGAAGGGAAGTGAGCTGGG + Intronic
952890031 3:38033720-38033742 GAGGACAAGGCCAATGTGGCTGG + Intergenic
953025674 3:39143590-39143612 GAGGAGGAGGAAGAGGAGGAAGG - Exonic
953203643 3:40800472-40800494 GAGGAGAAAGAAAGGGAAGCAGG - Intergenic
953358731 3:42276646-42276668 GAGGAGGTGGAAAGTGAGACAGG + Intergenic
953405829 3:42659340-42659362 GAGGAGGAGGAAGAGGAGGAAGG + Exonic
954038456 3:47866404-47866426 GAGGGGAAGAAAAAGGAGGAAGG + Intronic
954151149 3:48657751-48657773 GGGGAGAAGGGAAAGGTGGCTGG - Intronic
954264492 3:49461850-49461872 GAGGAGGAGGAGAAGGAGGGTGG - Intergenic
954725298 3:52603516-52603538 GAGAAGAAGAAAAAAGAGGTTGG - Exonic
955020907 3:55120205-55120227 GAGGAGTATGAAAATGAGTATGG + Intergenic
955283459 3:57616354-57616376 GAGGAGGAGGAGGAGGAGGCAGG + Intergenic
956375733 3:68611504-68611526 GAGGAGAAGAGAATTGGGGCAGG + Intergenic
956660196 3:71589899-71589921 TATGAGAAGGGAAATGAGGCAGG + Intergenic
956720406 3:72112569-72112591 TTGTAGAAGGAAAATGAGACTGG + Intergenic
956794532 3:72705742-72705764 GAGGAGGAGGAAGAAGAGGAGGG - Intergenic
956952264 3:74296253-74296275 GAGGAGAAGAAAAATGAGGGAGG + Intronic
957199001 3:77107926-77107948 AAGAAGAAAGAAAATGAGGCAGG - Intronic
957328501 3:78728208-78728230 GAGGAGAAGGAAAAGGAGGAAGG + Intronic
957501709 3:81066518-81066540 GAGGAGGAGGAAGAGGAGGGAGG - Intergenic
957520342 3:81311215-81311237 GAGGAGGAAGAAAAGGAGGAAGG + Intergenic
957755188 3:84476052-84476074 GAGGAGCAGGAAGAAGAGGAAGG + Intergenic
957805892 3:85148871-85148893 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
958154597 3:89740355-89740377 GAGGAGGAGGAGAAGGAGGGGGG + Intergenic
958415390 3:93867701-93867723 AAGGAAATGGAAAGTGAGGCAGG - Intergenic
959172274 3:102857911-102857933 GAGGAGGAGGAAGAGGAGGAGGG - Intergenic
959539903 3:107525327-107525349 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
959652011 3:108759223-108759245 GAAGAGAAGAAAAATGAGACTGG + Intergenic
959725081 3:109533626-109533648 GAGGAGAAGGAAAAGCAGGGAGG - Intergenic
959847461 3:111050825-111050847 GAGGAGGAGGAAGAAGAGGAGGG - Intergenic
959932927 3:112002564-112002586 GAGGAGGAGGAAGATGACTCAGG + Intronic
960911471 3:122653346-122653368 AAGGAAAAGGAAAAAAAGGCAGG + Intergenic
960936415 3:122906703-122906725 GGGGAGGAGGAAAAAGAGGAGGG + Intergenic
960936421 3:122906721-122906743 GAGGGGGAGGAAAAAGAGGAGGG + Intergenic
960999952 3:123367536-123367558 GAGGAGGAGGAAGCTGAGGGTGG - Intronic
961265052 3:125634927-125634949 GGGGAGAAGGAAGATGGGGCAGG + Intergenic
961345538 3:126260954-126260976 GGGGAGAAGGAAGAGGAGGGAGG - Intergenic
961520451 3:127464686-127464708 GAGGAGGAGGAATGTGAGGTGGG + Intergenic
961690532 3:128666259-128666281 GAGGGCTAGGAAAATGCGGCTGG + Intronic
961788195 3:129360055-129360077 GGGGAGAAGGGGAAGGAGGCAGG - Intergenic
961928561 3:130509393-130509415 CAGGAGTAGGGAAATGAGACAGG - Intergenic
962070589 3:132029565-132029587 GGGGAGGAGCAAAATCAGGCTGG - Intronic
962108247 3:132416076-132416098 GAGGAGGAGGAAAAAGAAACAGG - Intergenic
962498405 3:135965681-135965703 GAGGAGGAGGAGAAGGAGGTAGG + Exonic
962737575 3:138339405-138339427 GAGGAAAAGGGAGGTGAGGCAGG - Intergenic
962842835 3:139251426-139251448 GAGGAGAAGGAAATGGAGTTGGG - Intronic
962952186 3:140229486-140229508 GAGAAAAAGGAAAAGGAGGGTGG - Intronic
963032626 3:140993807-140993829 GAGGAGGAGGAAGAAGGGGCTGG - Intergenic
963049325 3:141128034-141128056 GAGGAGAAGAAAAAGAAGGCTGG + Intronic
963200855 3:142584585-142584607 GAGGAGAGAGAAAATGAGAAAGG - Intergenic
963274669 3:143318021-143318043 GAGAAGGAAGAAAATGAGGCCGG - Intronic
963390008 3:144649303-144649325 AAGGAAAAGGTAAATGATGCTGG - Intergenic
963550000 3:146707924-146707946 GAGGAGAAGGAACAAGATGGTGG + Intergenic
964037317 3:152215164-152215186 GAGGAGAAGGAAATTTTGGGTGG + Intergenic
964165699 3:153702698-153702720 GAGGAGAAGGAAGAAGAAGAAGG - Intergenic
964374545 3:156036088-156036110 GATAAGAAGGAAAACAAGGCTGG - Intergenic
964462925 3:156956237-156956259 GAGGAGAAAGCAAGTGAGGTAGG - Intronic
964495131 3:157280464-157280486 GAGGAGTAGGAAAGTGATGCTGG + Intronic
964676806 3:159292189-159292211 GAAGAGAAAGAAAAAGAGACAGG + Intronic
965338410 3:167456373-167456395 GAAGGCAAGGAAAATGAGACTGG - Intronic
965347238 3:167566958-167566980 GAGGAGGTGGAAAGGGAGGCAGG + Intronic
965553313 3:169992809-169992831 GAGAAAAAGGAAGATGAGGAGGG + Exonic
965678058 3:171220522-171220544 GAGGGGAATGAATATGAGGTGGG + Intronic
965888099 3:173474129-173474151 AAGGAAAAGGAAAAGGAGGAGGG - Intronic
966052200 3:175633050-175633072 GAGGAAGAGTAAAATGAGACAGG + Intronic
966059740 3:175740424-175740446 GAGGGCTAGGAAAATGAGGCTGG + Intronic
966314546 3:178631221-178631243 GAGAAGAAGGAATATGAAGTGGG - Intronic
966370944 3:179250150-179250172 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
966521915 3:180882423-180882445 GAGGAGGAGGAGAAGGAGGAAGG - Intronic
966598045 3:181745089-181745111 GAGGAGAAAGAAAAAAAGGAAGG - Intergenic
966760513 3:183413888-183413910 GAGGAGGAGGAAGAAGAGGAGGG + Intronic
966861601 3:184233676-184233698 AAGGAGAAGGTATATGGGGCAGG - Exonic
966879381 3:184341397-184341419 GAGGAGAGGGAAGAGGAGGAAGG - Intronic
966949594 3:184804189-184804211 GAGGAGGAGAAAAATAGGGCTGG - Intergenic
967054192 3:185813888-185813910 AAGGAGAAGGAGAATGAGAGAGG + Intronic
967164640 3:186769700-186769722 GAGGGCTAGGAAAATGAAGCTGG - Intergenic
967341708 3:188405910-188405932 GAGGAGGAGGAAAAGGAGGAAGG - Intronic
967365483 3:188681660-188681682 AAGGAGAAGGAAAAGGAGGGAGG + Intronic
968424614 4:514185-514207 AAGGAGAAGGGAAATGAGTGTGG - Intronic
968808520 4:2789801-2789823 CAGGAGAGGGAGGATGAGGCAGG + Intergenic
968844485 4:3032479-3032501 GAGGGGAAGAAAAATAAAGCAGG + Intronic
969150332 4:5163913-5163935 GAGGAGCAGGAAACACAGGCTGG - Intronic
969352880 4:6608309-6608331 GTGGGGAAGGAAAGGGAGGCAGG - Intronic
969428968 4:7142113-7142135 GATGAGGATGAAGATGAGGCAGG - Intergenic
969680902 4:8642853-8642875 GACAAGAAGGAAAATGTGGGTGG - Intergenic
969829090 4:9781197-9781219 GTGGAGAAGGAAACCAAGGCCGG + Intronic
969954804 4:10877995-10878017 AAGGAGGAGGAAAAGGAGGAAGG - Intergenic
969979534 4:11140494-11140516 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
970260132 4:14215864-14215886 GATGATAAGGAAAATGAGGAAGG + Intergenic
970338751 4:15082489-15082511 GAGGAGAAGGCAAAGGAGAAAGG + Intergenic
970661572 4:18291566-18291588 GAGAAGAAGGAAAAGCAGCCAGG + Intergenic
970681376 4:18512349-18512371 GAGTAAAAGGAAAAAGAGGAGGG - Intergenic
970867245 4:20773288-20773310 TAGGAGAAGGCAAAGGAGGGTGG - Intronic
970943997 4:21668997-21669019 GAGGAGGAGGAGAAGCAGGCAGG - Intronic
971017775 4:22506254-22506276 GATGAAAAGCAAAATAAGGCCGG + Intronic
971145998 4:23976959-23976981 GAGGAAAAGGAAAAGGAAGAAGG + Intergenic
971353620 4:25874504-25874526 AAGCAGAAGGAAAATAAGGAGGG + Intronic
971633812 4:29031262-29031284 GAGGAGAAGGAGGACGAGGAGGG - Intergenic
971669573 4:29539865-29539887 GAGGAGGTGGAAGAGGAGGCAGG + Intergenic
972207091 4:36786915-36786937 GAGGAGAAGAAAATTAAGCCAGG - Intergenic
972391283 4:38616032-38616054 GAGGAGGAGGAAAAAGGAGCAGG + Intergenic
972729651 4:41781588-41781610 AAGGGGAAGGAAATTTAGGCTGG + Intergenic
972884994 4:43474945-43474967 GAGGAGATAGAAAATGAGATGGG - Intergenic
972897476 4:43641317-43641339 GAAGAGAAGAAAAAAGAGGAGGG - Intergenic
972908716 4:43785920-43785942 AAGGAGACCGAAAATGAAGCTGG + Intergenic
973110285 4:46390007-46390029 GAGGAGGAGGAAGAGGAGGAGGG + Intronic
973151960 4:46899112-46899134 GAGGAGAAGGATAATGAGTTGGG - Intronic
973230473 4:47835235-47835257 GACCAAATGGAAAATGAGGCTGG - Intronic
974348516 4:60714505-60714527 AGGGATAATGAAAATGAGGCAGG - Intergenic
974389622 4:61249420-61249442 GAGGAGGAGGAGGGTGAGGCAGG - Intronic
974440341 4:61907917-61907939 GAGGGCTAGGAAAATAAGGCCGG - Intronic
974574264 4:63697795-63697817 GATGGCTAGGAAAATGAGGCTGG + Intergenic
974891602 4:67890763-67890785 GAGGAGAAGTAAACTGATGTTGG - Intergenic
975139089 4:70902294-70902316 GAGGGGAAGGAAAGGGAGGCGGG - Intergenic
975690278 4:76956305-76956327 ATAGAGAAGGAAAATGAGACAGG + Intronic
975705293 4:77105730-77105752 AAGGACTATGAAAATGAGGCTGG + Intergenic
975858705 4:78652813-78652835 GTGAATAAGGAAAATGATGCAGG - Intergenic
975964244 4:79950854-79950876 GAGGAGAGAGAACCTGAGGCTGG - Intronic
976359496 4:84160945-84160967 AAGAAGAAGGAAGATGAGGAAGG - Intergenic
976378878 4:84376873-84376895 GACGAGGAGGAAAAGGAGTCAGG + Intergenic
976379057 4:84378882-84378904 AATGAGAAGGAAGATGAGGCTGG + Intergenic
976635111 4:87279564-87279586 GAGGAGAGGCAGAATGAGGCGGG + Intergenic
976739187 4:88341267-88341289 GAGGAGAACACAAATGAAGCAGG - Intergenic
976999248 4:91475583-91475605 GAAGAGAAAGAAAAGGTGGCAGG - Intronic
977148949 4:93484237-93484259 GAGGAAAAGGAAATGGGGGCTGG - Intronic
977317434 4:95467988-95468010 GAGGAGCAGGAGGATGAGGAGGG + Intronic
977666982 4:99653641-99653663 GGGGAGGAGGAAAAGGAGGAGGG - Exonic
977788524 4:101069699-101069721 GAGGAGAAGGAAGAGGAAGAGGG - Intronic
977795317 4:101157573-101157595 TAGTACAAGGAAAATGAGACTGG + Intronic
978310268 4:107379607-107379629 GAGAAAAAGAAAAATGAGGTGGG - Intergenic
978311403 4:107388126-107388148 GAGAAAAAGGAAAATGGGGTTGG - Intergenic
978576756 4:110196888-110196910 GAGGAGAAGGAAGCGGCGGCCGG + Intronic
978637917 4:110832905-110832927 GAGAAGAAGAAAGAGGAGGCAGG + Intergenic
978701091 4:111647115-111647137 GAGGAGAAGGAGAGTGTGTCAGG + Intergenic
979113073 4:116783212-116783234 GCAGAGAAGAACAATGAGGCAGG + Intergenic
980309666 4:131109685-131109707 GAGGAGAGGGAGAGAGAGGCTGG + Intergenic
980482440 4:133404405-133404427 GAGGAGAAGGAATAAGAAGAGGG + Intergenic
980528560 4:134020559-134020581 GAGGGCCAGGAAAATGAGGCTGG - Intergenic
980714768 4:136615064-136615086 GAGGAGAAGGAAAAAAAAACTGG - Intergenic
980722151 4:136712301-136712323 CAGGATAAGGGGAATGAGGCAGG - Intergenic
980778731 4:137469036-137469058 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
980829219 4:138109465-138109487 GAGGGCTAGGAAAATGAGTCTGG + Intergenic
980844912 4:138312811-138312833 GAGGAGGAGGAGAAAGGGGCAGG - Intergenic
980875914 4:138661975-138661997 GAGGACTAGGAAAATGAGGTTGG - Intergenic
980909243 4:138978800-138978822 GAGGACTAGGAAAATGAGGCTGG + Intergenic
980931769 4:139189003-139189025 GAGGAGGAGGAGGAGGAGGCTGG - Intergenic
981025047 4:140069453-140069475 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981025062 4:140069514-140069536 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981358961 4:143825654-143825676 AAGGAGAAGGAAAACGAAGTTGG + Intergenic
981379479 4:144056498-144056520 AAGGAGAAGGAAAAGGAAGTTGG + Intergenic
981945366 4:150336565-150336587 GGGGAGAAGGAAAATTAGGGAGG + Intronic
981955946 4:150474364-150474386 GAGTACAATGAAAATGAGGAAGG + Intronic
982127932 4:152200321-152200343 GACTGGAAGGAAAGTGAGGCTGG - Intergenic
982171359 4:152664907-152664929 CAGGAGAATGAAAAGGAGTCAGG - Intronic
982274861 4:153628319-153628341 AAAGAGAAGAAAAATGAGGGAGG - Intronic
982346007 4:154360318-154360340 GTGGAGGAAGAAATTGAGGCTGG - Intronic
982505701 4:156214371-156214393 GAGAAGAGGGAAAATGCCGCTGG + Intergenic
982753969 4:159196692-159196714 GATGAGAATGACAATGATGCTGG - Intronic
982769379 4:159381915-159381937 GAGGAGGAGGAGGATGAGGCAGG + Intergenic
983379832 4:166978676-166978698 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
983655966 4:170084974-170084996 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
983932990 4:173473622-173473644 GTGCATAAGGAAAAAGAGGCAGG + Intergenic
984097664 4:175451773-175451795 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
984334512 4:178372399-178372421 GAAGAGGAGGAAAAAGAGGTTGG - Intergenic
984428440 4:179617705-179617727 GATGAGAAGGTAAATGAGACAGG + Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984653012 4:182289733-182289755 GAGGTGTATGAAAATGAAGCAGG + Intronic
984694074 4:182761658-182761680 AAGGAAAAGGAAAATAAAGCAGG - Intronic
984729573 4:183055136-183055158 GAGGAGGTGGAAGAGGAGGCAGG - Intergenic
984979715 4:185267993-185268015 GAGGAGGAAGAGAATGAGGAGGG + Intronic
985217002 4:187664197-187664219 GAGGGGCAGGAAAATGATGCTGG - Intergenic
985958433 5:3281748-3281770 GGGAAGAAGGAAAAGGAAGCAGG + Intergenic
986195284 5:5532581-5532603 GAGCAGAAGGAAGACCAGGCAGG - Intergenic
986278658 5:6304545-6304567 GAGGAAAAGAAAAAGGAGACGGG + Intergenic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
986636068 5:9823615-9823637 GAGGAGAGGGAAAGGGAGGAAGG + Intergenic
986811979 5:11369711-11369733 GTGTTGAAGAAAAATGAGGCAGG + Intronic
986953349 5:13119304-13119326 GAGGAGGAGGAAGAGGAGGTAGG + Intergenic
987190883 5:15477198-15477220 AGGGAGAAGGAAAATGGGGAGGG - Intergenic
987678359 5:21104778-21104800 GAGGAGCAGGAAGATGAAGGTGG + Intergenic
987734064 5:21816170-21816192 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
987815742 5:22899624-22899646 GATGAGAGAGAAAAGGAGGCAGG + Intergenic
988089626 5:26519794-26519816 AAGGAGAAGGAAAAAGAAGAAGG + Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988617890 5:32793129-32793151 GAGGAGGAGGAAGATGAGCAGGG + Intergenic
988797810 5:34668076-34668098 GAGAAGAAAGAAAATGCAGCCGG - Intronic
988839268 5:35067057-35067079 GAGGATAAGAAAAAAGAGGCCGG - Intronic
988890306 5:35609509-35609531 GAGGAGAAGGTAAGAGAGGGAGG - Intergenic
989410135 5:41110844-41110866 GAGGAGAAGGAAGAGGAAGGGGG - Intergenic
989448947 5:41564388-41564410 GAATAGAAGTGAAATGAGGCTGG - Intergenic
989586036 5:43074479-43074501 GAGGAGAAAGACAATCAGGGTGG + Intronic
989654620 5:43733135-43733157 AAGGAGAAGGAAAAAGTGGTGGG - Intergenic
989742121 5:44785607-44785629 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
989743075 5:44794562-44794584 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
989756220 5:44958785-44958807 GAGAAGAAGGAAAAAGAAGGAGG - Intergenic
989814844 5:45723260-45723282 GAGGAGAAAGAAAATGAAAAGGG + Intergenic
989948228 5:50265345-50265367 GATGAGAAGGAATAAGAGGAGGG - Intergenic
989952916 5:50322244-50322266 GAGGAGAAGGAGAGAGATGCAGG - Intergenic
989995113 5:50819852-50819874 GAGTAGAAGGAATGTGAGGGTGG + Intronic
989997215 5:50849984-50850006 GTGGTGGTGGAAAATGAGGCTGG - Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990173254 5:53078917-53078939 GAGAAGAAAAAAAATGAGTCTGG + Intronic
990182299 5:53174522-53174544 GAGGAGAAGGAAGAAGGGGAAGG + Intergenic
990198616 5:53346429-53346451 CAGGAAAAGAGAAATGAGGCTGG + Intergenic
990549141 5:56855113-56855135 GAGGAGGAGAAAAAGGAGGAGGG - Intronic
990570999 5:57078773-57078795 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
990599414 5:57342423-57342445 GAAGAAAAGTAAAATGAGTCAGG - Intergenic
990640053 5:57772940-57772962 GAGGAGATGGTAAATTAGGTGGG + Intergenic
990909686 5:60841490-60841512 GAGGAGAGAGAAAATAAGACTGG - Intronic
991511070 5:67376695-67376717 GAGAAGAAGGAAGAAGATGCAGG - Intergenic
991669965 5:69037800-69037822 GAGAAAAAGGAAAATGAGGCTGG + Intergenic
991680524 5:69134895-69134917 GAGGGGAGGGGGAATGAGGCAGG + Intergenic
991956320 5:71998806-71998828 GAGGAGAAGGAGGCTGAGGTAGG + Intergenic
992112595 5:73510072-73510094 GAGAAGGAGGAAAGTGAGGGAGG + Intergenic
992215431 5:74520233-74520255 GAGGAGAAGGAAGAAGAAGAAGG + Intergenic
992379826 5:76226207-76226229 GGGCAGAAGGAAAATGAGTTGGG + Intronic
992676943 5:79114447-79114469 GAAGAGAATGAAAATGAGGGAGG + Intronic
992812841 5:80407440-80407462 GAAGGGAAGGAAAGTGTGGCTGG + Intergenic
992994458 5:82318661-82318683 GAGGAGGAGGAAAGGGAGGGAGG + Exonic
993021136 5:82592477-82592499 GAGGAGGAGGAGAAGGAGGAAGG - Intergenic
993033373 5:82729877-82729899 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
993043130 5:82837839-82837861 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
993061268 5:83041904-83041926 GAGAAGCAGGAAGATGAAGCTGG + Intergenic
993064946 5:83086624-83086646 GAGGAGGTGGAAGAGGAGGCAGG + Intronic
993752131 5:91683218-91683240 AAGGAGAAGGAAAATCAAGGAGG - Intergenic
994889896 5:105620049-105620071 CAGGAGAAAGAAAATAGGGCAGG - Intergenic
995035147 5:107525709-107525731 GAGGAGAAGGAGAAAGAAGAGGG + Intronic
995214732 5:109582348-109582370 GAGGAGAAGGAAGAGGAGGGGGG + Intergenic
995214745 5:109582412-109582434 GAGGAGGTGGAAAGAGAGGCGGG + Intergenic
995264772 5:110145821-110145843 GAGGAGGAGGAAAAAGAAGAAGG - Intergenic
995313503 5:110739490-110739512 GATGAGAAGGAATAGGAGGCGGG - Intronic
995481325 5:112595927-112595949 GTGGAGAAGGATGATGGGGCAGG - Intergenic
995919956 5:117299826-117299848 GAAGAAAAAGAAAATGAGGTGGG + Intergenic
996165745 5:120220734-120220756 GAGGAGGAGGAAAAGGAGGTGGG - Intergenic
996425388 5:123308097-123308119 GAGGAGAGGTAATATGAGGAAGG - Intergenic
996517718 5:124391763-124391785 AAAAAGAAGGAAAATCAGGCCGG + Intergenic
996947448 5:129087713-129087735 AAAGAGAAGAAAAAGGAGGCAGG + Intergenic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997084271 5:130778519-130778541 GAGGAGAAGGAAGAAGAGGAGGG + Intergenic
997099482 5:130953223-130953245 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
997278536 5:132620953-132620975 GAGGAGGAGGAAGAAGAGGAGGG + Intronic
998005943 5:138657099-138657121 GAGGGGAAGGTGAATGTGGCTGG + Intronic
998164727 5:139836497-139836519 GAGGAGAAGGAAGACTAGGAAGG + Intronic
998484086 5:142486597-142486619 GAGGAGGAGGGAAAGGAGGAAGG - Intergenic
998507438 5:142683319-142683341 GAGGGCTGGGAAAATGAGGCTGG + Intronic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
999089308 5:148921372-148921394 GAGAAGGAGGAAAAGGAGGATGG + Intergenic
999137219 5:149329952-149329974 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
999342214 5:150782038-150782060 GAGCAGATGGAAACTCAGGCAGG + Intronic
999363061 5:151002449-151002471 TAGGATAAAGAAAAAGAGGCTGG + Intergenic
999551762 5:152695265-152695287 GCTGAGAAGAAAAATGAGGCTGG - Intergenic
999592046 5:153158838-153158860 CAGGAAAAGGAAAAGCAGGCGGG - Intergenic
999623035 5:153491242-153491264 GAGGAAAAAAAAAATCAGGCTGG + Intronic
999706340 5:154275774-154275796 GAGAACAAGGAAAATGTGCCTGG + Intronic
999725238 5:154431397-154431419 GAGGTGATGGAAAAGTAGGCAGG - Intergenic
1000199908 5:158997970-158997992 GAGGGGAAGGAAATGGTGGCAGG - Intronic
1000765530 5:165284753-165284775 AATGAAAAGAAAAATGAGGCTGG + Intergenic
1000776531 5:165426537-165426559 GAGAAGGAGGAAAAAGAGGAGGG - Intergenic
1000835904 5:166153854-166153876 TAGAAAAAGGAAAATGAGGCTGG - Intergenic
1001040728 5:168333244-168333266 GAGGAGAAAGGGAAAGAGGCGGG - Intronic
1001100647 5:168811008-168811030 TAGGAGAAGAACAATGTGGCTGG - Intronic
1001680707 5:173555073-173555095 GCAGAGAGGGAAACTGAGGCAGG + Intergenic
1001711460 5:173781968-173781990 GAGAAGAAAGAAGATGAGTCAGG + Intergenic
1001722005 5:173864586-173864608 CAGGAGACGGAAAGTGAGGTTGG + Intergenic
1002298099 5:178242288-178242310 GAGGAGAGGGGGAAGGAGGCAGG - Intronic
1002327686 5:178420523-178420545 GGGGAGGAGGAAAGTGAGGAGGG - Intronic
1003154544 6:3579672-3579694 CAAGAGAAGGAACATGAGGCCGG - Intergenic
1003406751 6:5832548-5832570 GAGGAGGAGGAAGAGGAGGGGGG + Intergenic
1003610168 6:7606178-7606200 GAGAAGAAGGAAAGAGAGGTGGG + Exonic
1003777885 6:9389882-9389904 GAGAAGATGAAAAAGGAGGCAGG + Intergenic
1003856940 6:10286045-10286067 GAGGAGGAGGAGAAGGAGGGAGG + Intergenic
1004081235 6:12395457-12395479 GAGGACAAAGAAAGAGAGGCAGG + Intergenic
1004122106 6:12833843-12833865 GAGTAGAAGGAGAGGGAGGCTGG - Intronic
1004251889 6:14029596-14029618 AAAAATAAGGAAAATGAGGCTGG + Intergenic
1004294458 6:14397563-14397585 GAGGAGAAGGCAATTGAGGAAGG - Intergenic
1004698796 6:18059165-18059187 GAGGAGGAAGGAAAGGAGGCAGG - Intergenic
1004937571 6:20522787-20522809 GAGAAGAAAGAAAATCAGCCAGG - Intergenic
1004943548 6:20586888-20586910 GAAGAGCAAGAAAATGAGGGCGG - Intronic
1005352202 6:24947708-24947730 GAGGAGAAGGAAAAAGTAGGGGG + Intronic
1005506869 6:26476975-26476997 GAGGAGGAAGAAAATGAGAGTGG - Intergenic
1005513319 6:26531376-26531398 CAGGAGAGTGGAAATGAGGCAGG + Intergenic
1005515451 6:26550314-26550336 GAGGGCTAGGAAAACGAGGCCGG - Intergenic
1005687417 6:28268119-28268141 GCAGAGAAGGAAATTGAGACGGG - Intronic
1005896921 6:30186291-30186313 GAGGAGGAGGAAGAGGAGGCCGG - Exonic
1005939803 6:30552568-30552590 GAGGAGGAGGAAGAGGAGGATGG - Exonic
1006130891 6:31868937-31868959 GTGGGGAGGGAAACTGAGGCTGG - Intronic
1006268855 6:32948909-32948931 GAGGAGAAGGAGGAGGAGGATGG - Intronic
1006304162 6:33208761-33208783 GAGGAGAAGGCGAAGAAGGCTGG - Exonic
1006410532 6:33870940-33870962 GAGGGGAAGGAAAGTGATGTGGG - Intergenic
1006632846 6:35441679-35441701 GAGGAGGAGGGAAAGGGGGCGGG + Intergenic
1006834210 6:36986688-36986710 GAGGAGATGGAAAATGCGATCGG - Intergenic
1007414267 6:41682966-41682988 GGAGAGAAGGAAAATGGGCCGGG - Intergenic
1007524184 6:42476776-42476798 GTAGAGAAGAAGAATGAGGCTGG - Intergenic
1007655396 6:43448415-43448437 GAAGAGAAGGCAGAAGAGGCAGG - Intronic
1007708130 6:43803935-43803957 GAGGAGAAGGAAGAGGAGAGAGG + Intergenic
1007827105 6:44608762-44608784 GAGGAGGAGGAGAAGGAGGATGG - Intergenic
1007874401 6:45079406-45079428 GAGGAGAAGGAAGAAGAAGGGGG + Intronic
1008402432 6:51079226-51079248 GAGGATGAGGGAAGTGAGGCAGG + Intergenic
1008952997 6:57181329-57181351 GTGGAGAGGGAAAATCAGGTAGG + Intronic
1009058883 6:58373629-58373651 GAGGAGGAGGAAGATGAAGAGGG + Intergenic
1009231961 6:61073484-61073506 GAGGAGGAGGAAGATGAAGAGGG - Intergenic
1009294686 6:61931790-61931812 GAGGAGGTGGAAGAGGAGGCAGG - Intronic
1009611643 6:65950318-65950340 AAGGAGAAGGAAAATGTGGTTGG - Intergenic
1010041671 6:71391907-71391929 GAGGAAGAGGAAAATGAGGCTGG - Intergenic
1010047982 6:71469801-71469823 GAAGAGAAGGCAAATGAGGAGGG - Intergenic
1010229078 6:73519561-73519583 GGGGACAAGGAAATTGAAGCTGG - Intronic
1010284170 6:74055701-74055723 GAGGAGAAAGAAAAGGAGATGGG + Intergenic
1010295037 6:74185640-74185662 AAGTAGAAGGAAAAGGAGGCAGG + Intergenic
1011027137 6:82881404-82881426 GAGGAGGAGGATTATGAGGAGGG + Intergenic
1011114589 6:83875953-83875975 GAGGGCTAGGAAAAAGAGGCTGG - Intronic
1011258559 6:85449571-85449593 GAGGAGGAGTAAAGAGAGGCCGG - Intronic
1011354669 6:86461711-86461733 GAGGAGGAGGAAAAGGATGGGGG + Intergenic
1011570772 6:88732044-88732066 GAGGAGATGGAAGAAGAGGAGGG + Intronic
1011607619 6:89119483-89119505 GAAGAGTTGGAAAATGAGGCTGG + Intergenic
1011778694 6:90761875-90761897 GAGGAGGAGGAAGAAGAGGAGGG + Intergenic
1011869439 6:91874080-91874102 CCAGAGAAGAAAAATGAGGCTGG + Intergenic
1012048786 6:94312622-94312644 TAGTAAAAGAAAAATGAGGCCGG + Intergenic
1012274905 6:97261372-97261394 GAGGAGGAGGAAGAAGAGGAGGG - Intronic
1012409281 6:98937624-98937646 GAGGAGGTGTAAAAAGAGGCAGG + Intronic
1012564887 6:100636426-100636448 GAGGAGAAGGAAAGAGATGGGGG - Intronic
1012912272 6:105131938-105131960 AATGACAAGGAAAAAGAGGCTGG - Intronic
1013213384 6:108006138-108006160 GAGGGCCAGGAAAATGAAGCTGG + Intergenic
1013325235 6:109039081-109039103 GAGGAAAAGGAGAAGGAGGGAGG + Intronic
1013325239 6:109039100-109039122 GAGGAGAAGGAGAAGGAAGGAGG + Intronic
1013351928 6:109313605-109313627 GAGGAGAAGAAACAGGAGGTAGG + Intergenic
1013668823 6:112376151-112376173 GAGGAGAAGGAAAATGAGGGAGG + Intergenic
1013934102 6:115572233-115572255 GAGGAGAATGAAATTGAAGATGG - Intergenic
1014072015 6:117193232-117193254 GAGAAAAAGCAAAATGAGGTGGG - Intergenic
1014156130 6:118111888-118111910 GAGGGCTAGGAATATGAGGCTGG + Intronic
1014465401 6:121750370-121750392 AAGGAAGAGGAAAATGGGGCAGG + Intergenic
1014567947 6:122973866-122973888 GAGGAGACGAAGAATGAGGATGG + Intergenic
1014617553 6:123622128-123622150 GAGGAGGAGGAAAAAGAGGAAGG - Intronic
1014904706 6:127012023-127012045 AAGAAAAAGGGAAATGAGGCAGG - Intergenic
1014911245 6:127096155-127096177 GAGAAATAGGAAACTGAGGCAGG + Intergenic
1014916020 6:127149410-127149432 TATGAGAAGGGAAGTGAGGCTGG - Intronic
1015088082 6:129320263-129320285 GAGGAGGAGGAAGAAGAGGAGGG + Intronic
1015149477 6:130020716-130020738 GAGGGGGAGGAAAAGGAAGCGGG - Intronic
1015332853 6:132001649-132001671 GAGGGCAGGGAAAATGAGGCTGG + Intergenic
1015370099 6:132440832-132440854 GAGGGCAGGGAAAATGAGGCTGG - Intergenic
1015445577 6:133300211-133300233 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
1015590608 6:134819331-134819353 GAGATGAAGAAAAATGAGGGGGG - Intergenic
1015857104 6:137636511-137636533 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1016010730 6:139135457-139135479 GACGAGCAGGAAAATGGAGCCGG + Exonic
1016245912 6:141980599-141980621 GAAGAGAAGGAAAGGGAGGATGG + Intergenic
1016249749 6:142026722-142026744 GAGGGCCAGGAAAATGAGGCTGG - Intergenic
1016330103 6:142945960-142945982 GAGGAGGAGGAGAAGGAGGACGG + Intergenic
1016643534 6:146378187-146378209 GTGCAGAAGGAAAATGTGGGGGG + Intronic
1016801487 6:148173541-148173563 GAGGAGGAGGAAGAGGAGGGGGG + Intergenic
1016805401 6:148207143-148207165 GAGGACATGGAAAATCAGGGTGG - Intergenic
1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG + Intergenic
1017041836 6:150314319-150314341 GAGGAAGAGGAAAAGGAGGAGGG + Intergenic
1017473671 6:154766248-154766270 GAGGAGAGGGAAGGGGAGGCAGG + Intronic
1017665256 6:156713746-156713768 GAGGAGGAGGCAAAGGAGGAGGG + Intergenic
1018023966 6:159789658-159789680 GGCGGGAAGGAAAAAGAGGCAGG + Exonic
1018306373 6:162461203-162461225 GAAGAGAAAAAAAAGGAGGCTGG + Intronic
1018477437 6:164157642-164157664 ATGGAGAAGGAAAACGAGGCTGG + Intergenic
1018861771 6:167715655-167715677 GAGGAGGAGGAAGAGGAGGGTGG + Intergenic
1018928795 6:168225922-168225944 GGGGAGAAGGAGAAGGAGGAGGG - Intergenic
1018973932 6:168549593-168549615 GAGGAGGAGGAAGAGGAGGAGGG + Intronic
1019013341 6:168860923-168860945 GAGGAGAGGGAGAAAGAGGAAGG + Intergenic
1019198060 6:170293712-170293734 GAGGAGAAGGAAGAAGAGGAAGG - Intergenic
1019404615 7:877018-877040 GAGGGGAAGGAAGCCGAGGCGGG - Intronic
1019419103 7:942473-942495 GAGGAGGAGGAAGAGGAGGAAGG + Intronic
1019419144 7:942634-942656 GAGGAGGAGGAAGAGGAGGAAGG + Intronic
1019419179 7:942761-942783 GAGGAGGAGGAAGAGGAGGAAGG + Intronic
1019419209 7:942870-942892 GAGGAGGAGGAAGAGGAGGAAGG + Intronic
1019419257 7:943061-943083 GAGGAGGAGGAAGAGGAGGAAGG + Intronic
1019419329 7:943344-943366 GAGGAGGAGGAAGAGGAGGAAGG + Intronic
1019737882 7:2659480-2659502 GAAGAAAAAGAAAAGGAGGCAGG - Intronic
1019791586 7:3017479-3017501 GAGGCTGAGGAAAATAAGGCTGG + Intronic
1019855187 7:3598604-3598626 GGGGACAAGGGAAATGAGGAAGG - Intronic
1019954900 7:4405751-4405773 GAGAAGGAGGAAAATTAGGAGGG + Intergenic
1019954951 7:4405971-4405993 GAGAAGGAGGAAAATTAGGAGGG + Intergenic
1019965276 7:4493819-4493841 GAGGCGAAGGAGAAGCAGGCAGG + Intergenic
1020025451 7:4896593-4896615 GAGGAGGTGGAAATGGAGGCTGG - Intergenic
1020026813 7:4905350-4905372 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1020086408 7:5313035-5313057 GAGGAGGAGGAGGAGGAGGCCGG + Exonic
1020179262 7:5908724-5908746 AAGGAGACAGACAATGAGGCTGG - Intronic
1020190027 7:5988450-5988472 AGGGAGAATGAGAATGAGGCAGG + Intronic
1020292895 7:6736225-6736247 AGGGAGAATGAGAATGAGGCAGG - Intergenic
1020303672 7:6816131-6816153 AAGGAGACAGACAATGAGGCTGG + Intronic
1020390500 7:7652595-7652617 GAGAAGTAGGATAAAGAGGCAGG + Intronic
1020423229 7:8034723-8034745 AAAAAGAAGGAAAAAGAGGCTGG + Intronic
1020572962 7:9889853-9889875 GAGGAGAAGGAAGAAGGGGGAGG + Intergenic
1020577336 7:9949778-9949800 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1020577394 7:9949989-9950011 GAGGAGGAGGAAGAGGAGGAGGG + Intergenic
1020956755 7:14748538-14748560 GAGGAGCAGGAAATTGGAGCAGG + Intronic
1021574089 7:22091752-22091774 GAGGGCGAGGAAAACGAGGCTGG - Intergenic
1021592029 7:22273979-22274001 GATGACAAGGTAAATGAGGATGG - Intronic
1021675492 7:23076532-23076554 TAGGGGAAGGACAATGAGGAAGG + Intergenic
1021850292 7:24801401-24801423 GAGGAGAAGAATCAGGAGGCTGG - Intronic
1021882655 7:25109484-25109506 GAGGAAAAGGAAATTCAAGCTGG + Intergenic
1021956361 7:25828834-25828856 GGGGAGATGGAAAATGGGGATGG + Intergenic
1022091557 7:27110980-27111002 GGGGAGAAGGAGAATGAGTGAGG + Intronic
1022215234 7:28253204-28253226 AAGGAGAAGGAGAAGGAAGCAGG - Intergenic
1022477822 7:30723308-30723330 GAACAGATTGAAAATGAGGCAGG - Intronic
1022503458 7:30896669-30896691 GAGGGGAGGCAAAAGGAGGCAGG - Intergenic
1022734025 7:33059427-33059449 GAAGAGAAGGAAAAAATGGCAGG - Intronic
1022818694 7:33937903-33937925 AGGGTGATGGAAAATGAGGCTGG - Intronic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1022845786 7:34208450-34208472 GAGAAGAAGGAAAAGAAGGTAGG - Intergenic
1023045174 7:36204423-36204445 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1023119764 7:36897564-36897586 GAGGAGTAGGAGAAGGAAGCTGG + Intronic
1023293008 7:38686920-38686942 GAACAGAAAGAAAATGAGGCTGG + Exonic
1023350234 7:39313195-39313217 CAGGAGGAGGGAAGTGAGGCTGG - Intronic
1023369859 7:39502407-39502429 GAGGACAAAGAAAAGGTGGCAGG - Intergenic
1023568358 7:41547527-41547549 GAGGGCTAGGAAAATGAAGCTGG - Intergenic
1024104352 7:46067066-46067088 GAGGAGGAGGAAAAGGAGATGGG - Intergenic
1024168364 7:46758110-46758132 GAGGAGAAAGAAAGAGAGGAAGG + Intronic
1024183429 7:46921839-46921861 GAAGAAAAGGAAAAGGAGGAAGG + Intergenic
1024233103 7:47377767-47377789 GGGGAGAAGGAGAAGGAGGGAGG - Intronic
1024580017 7:50793549-50793571 GAGGAGCAGGAAAAGTAGCCGGG - Intergenic
1024641410 7:51331842-51331864 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
1024674030 7:51622156-51622178 GAGGGCTAAGAAAATGAGGCTGG - Intergenic
1024835407 7:53512336-53512358 GAGGAGAAAGAAAAAGAGAGAGG + Intergenic
1024999561 7:55303694-55303716 GAGGGGAAGGAAGAGGAGGGAGG + Intergenic
1025057917 7:55779961-55779983 AAGAAGATGAAAAATGAGGCTGG - Intergenic
1025664037 7:63572796-63572818 GAGGAGGAGGAGGAGGAGGCCGG + Intergenic
1025732917 7:64122388-64122410 GAAGTAAAAGAAAATGAGGCCGG + Intronic
1025770538 7:64501237-64501259 GAGGAGGAGGAAAATGTGCTGGG - Intergenic
1025931314 7:65996885-65996907 GAAGTCAAAGAAAATGAGGCTGG - Intergenic
1026123804 7:67561805-67561827 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1026126162 7:67581647-67581669 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
1026191892 7:68136436-68136458 GAGGAGAAGGAGAAGAAGGAAGG + Intergenic
1026191906 7:68136493-68136515 GAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1026205742 7:68255669-68255691 GAGGAGAAAGAAAAGGAGAAAGG - Intergenic
1026328998 7:69335886-69335908 GCTGAAAAGGAAAGTGAGGCTGG - Intergenic
1026360787 7:69599464-69599486 GAGGAGAAAGAAAAGGGGGAAGG - Exonic
1026404879 7:70054936-70054958 GAGGAGAAGGAAAAGCAGAAAGG - Intronic
1027214435 7:76174681-76174703 GAAGATGTGGAAAATGAGGCTGG - Intergenic
1027261258 7:76466043-76466065 GGGGAAAAGGAGAATGAGGAAGG + Intronic
1027312642 7:76964151-76964173 GGGGAAAAGGAGAATGAGGAAGG + Intergenic
1027512549 7:79101426-79101448 TAGAAAAAGGAAAATGGGGCCGG + Intronic
1027679471 7:81202138-81202160 ACAGAGAAGGAAAATGAGACAGG + Intergenic
1027738840 7:81973565-81973587 GAGGAGAAGGAAAAGGAGGGAGG + Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1027923568 7:84429833-84429855 TGGGAGGAAGAAAATGAGGCAGG + Intronic
1028015334 7:85703844-85703866 GAGGGTTAGGAAAATGATGCTGG + Intergenic
1028207691 7:88035097-88035119 AAGGAGCAAGAGAATGAGGCAGG - Intronic
1028307627 7:89285911-89285933 GAGGAGAAGGAAGAAGAAGAGGG - Intronic
1028618880 7:92801920-92801942 GAGGAGACGAAAAGAGAGGCGGG - Intronic
1028829355 7:95310578-95310600 GAGGATGAGGAAAATGAGATTGG - Intronic
1028864523 7:95692362-95692384 GAAAAGAATGGAAATGAGGCAGG - Intergenic
1029191503 7:98775476-98775498 GAGGACAAGGAAAGTCATGCCGG + Intergenic
1029306475 7:99623583-99623605 CAGGAAAAGGGAAATGATGCTGG - Intronic
1029524551 7:101087077-101087099 GAGGAGGAGGAGAAGGAGGAGGG + Exonic
1029577595 7:101413675-101413697 GAAGGGAAGGGAAATGAGGAAGG + Intronic
1029610017 7:101621922-101621944 GAAGAGAGGGAAACCGAGGCAGG + Intronic
1029871046 7:103693035-103693057 GATGAGGATGAAAATTAGGCTGG + Intronic
1030034445 7:105396689-105396711 GAGGAGAAGGAGGAGGAGGAAGG + Intronic
1030177110 7:106665948-106665970 GAGGAGAAAAAATATGAGGCTGG + Intergenic
1030528123 7:110677990-110678012 GAGGATGAAGAAAATGATGCTGG - Intronic
1030583075 7:111384174-111384196 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
1030607812 7:111656896-111656918 AAGGAGAATGAAAATGAGCAGGG + Intergenic
1031150768 7:118051573-118051595 GAGGAGAGGGAAGAGGAGGTGGG - Intergenic
1031379941 7:121073324-121073346 GAGGAGATGGAAAAAGAGGAGGG + Intronic
1031649561 7:124270702-124270724 GAGGAGGAGGAAGAAGAGGAGGG + Intergenic
1031681599 7:124681415-124681437 GAGGAGGTGGAAAGGGAGGCAGG - Intergenic
1031744197 7:125472743-125472765 GAGGAAAGGGAAAATGAGGTGGG + Intergenic
1032090156 7:128907517-128907539 GAGGGGTGTGAAAATGAGGCAGG + Intronic
1032142516 7:129345673-129345695 GAAAAGAAGGAAAATGAAACTGG + Intronic
1032235520 7:130118789-130118811 GAGGAGAGGGAAAAAGATGAGGG + Intronic
1032523275 7:132561942-132561964 GAGGAGGAGGAGAAAGAGGAGGG - Intronic
1032819250 7:135509758-135509780 GAGGAGGGTGAAGATGAGGCGGG + Intronic
1032908109 7:136396094-136396116 GAGGAGGAGGAAAGGAAGGCAGG + Intergenic
1032948708 7:136882402-136882424 GAGGAGAAGGAAGGTGAAGAGGG - Intronic
1033078194 7:138269177-138269199 GAGAAGAATAAAAATGGGGCTGG + Intergenic
1033332524 7:140428334-140428356 GAGGAGCAGCAGAATGCGGCTGG - Intergenic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1034022164 7:147656519-147656541 GAGGAGAAGGCAAAAGATGAGGG + Intronic
1034075971 7:148231550-148231572 GATGAGAATGAAAAAGAGGGAGG - Intronic
1034087795 7:148335967-148335989 GAAGGGAAGGAGAATGAGGGAGG - Intronic
1034152150 7:148925475-148925497 GAGGAGAGGCAACATGAGGACGG + Intergenic
1034317815 7:150150049-150150071 GCAGGGAAGGAAAATGGGGCTGG - Intergenic
1034393345 7:150802033-150802055 AAGGAGAAAGAAGAAGAGGCAGG - Intronic
1034396503 7:150829673-150829695 GGGGAGGATGAAGATGAGGCAGG - Intronic
1034606811 7:152323782-152323804 GAGGGGAAGGGAAGGGAGGCAGG + Intronic
1034623578 7:152475247-152475269 GAAGAAATGGAAGATGAGGCCGG + Intergenic
1034774937 7:153817203-153817225 GCAGGGAAGGAAAATGGGGCTGG + Intergenic
1035419659 7:158717113-158717135 GAGAAGAAGGAAAAAGAAGGAGG - Intergenic
1035419676 7:158717196-158717218 GAGGAGAAGGAAGAAGAAGGAGG - Intergenic
1035419686 7:158717252-158717274 GAGGAGAAGGAAGAAGAAGGAGG - Intergenic
1035419712 7:158717401-158717423 GAGGAGAAGGAAGAAGAAGGAGG - Intergenic
1035419728 7:158717484-158717506 GAGGAGAAGGAAGAAGAAGGAGG - Intergenic
1035419762 7:158717657-158717679 GAGGAGAAGGAAGAAGAAGGAGG - Intergenic
1035419772 7:158717707-158717729 GAGGAGAAGGAAGAAGAAGGAGG - Intergenic
1036450213 8:8859549-8859571 GAGGAGGAGGAAGAAGAGGAGGG - Intronic
1036546186 8:9771787-9771809 GAGGAGAAGGGAAGTGGGGGAGG + Intronic
1036612983 8:10366000-10366022 AAGGAGCAGGGGAATGAGGCAGG - Intronic
1036705506 8:11043392-11043414 AAGGAGCAGGAAGAGGAGGCTGG - Intronic
1036760753 8:11507205-11507227 GTGGGGAAGGAAACTGAAGCGGG + Intronic
1036973089 8:13376951-13376973 GAGGAGAAGGAAAAAAAATCTGG + Intronic
1037608014 8:20453771-20453793 GAAGAGGAGGAGAAGGAGGCTGG + Intergenic
1037755981 8:21710309-21710331 GCAGAGAAGGAAGATGAGGATGG - Intronic
1037779538 8:21858310-21858332 GAGGAGGGGGAAATGGAGGCAGG + Intergenic
1038010972 8:23475518-23475540 GAGGCGTAGGAGAATGAGTCAGG - Intergenic
1038120387 8:24607967-24607989 GAGGAGGAGGAAAAGGAGAAGGG + Intergenic
1038350564 8:26772425-26772447 GCGGAGAAGGAAAAGGAGCTTGG - Intronic
1038483731 8:27919130-27919152 GAGGAGAAGGAAGAAGGGGATGG + Intronic
1038781169 8:30569313-30569335 GAGGAGAAGGAAAAGGTCTCAGG + Intronic
1039111276 8:34043050-34043072 GAGGAGGAGGAGAATGTGCCAGG + Intergenic
1039118293 8:34116852-34116874 GAGGAGAAAGAGAATCAGGGAGG + Intergenic
1039126039 8:34203032-34203054 GAGGAGATAGAAAAAGAAGCAGG - Intergenic
1039241009 8:35556869-35556891 GAGGGCTAGGAAAATGAGGCTGG - Intronic
1039340112 8:36638741-36638763 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1039351613 8:36769878-36769900 GAGGAGCAGCCAAATGAGGAGGG - Intergenic
1039435984 8:37559560-37559582 GAGGAGGAGGAAAAGAAGGAGGG + Intergenic
1039436012 8:37559668-37559690 GAGGAGGAGGAAAAGGAGGAGGG + Intergenic
1039436022 8:37559701-37559723 GAGGAGAAGGAAAAGGAGGAGGG + Intergenic
1039482165 8:37882242-37882264 GAGGGCTAGGAAAATGAGGCTGG + Intronic
1039496054 8:37981089-37981111 GAGGGGAAGGAACTTAAGGCTGG + Intergenic
1039627469 8:39068748-39068770 GAGGTGAGGGAAAATAAGGCTGG + Intronic
1040029921 8:42814741-42814763 AAGGAGGAGGAAGATGAAGCGGG + Intergenic
1040033181 8:42844217-42844239 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1040071952 8:43195705-43195727 GAGGAGGAGGAAGAGGAGGAGGG + Intronic
1041177642 8:55213149-55213171 GAGGGTTAGGAAAATGAGGCTGG - Intronic
1041267616 8:56080364-56080386 GAGGAGAAGGAGAAGGCGGAAGG + Intergenic
1041411749 8:57563854-57563876 GATGAGAAGGAAGAGGAGGCAGG - Intergenic
1042076670 8:65003246-65003268 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1042104976 8:65316440-65316462 GATGAGAAGGAAAGGAAGGCAGG + Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042208307 8:66351262-66351284 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1042280437 8:67050295-67050317 TAGGAGAAAAAAAAAGAGGCCGG - Intronic
1042767283 8:72337337-72337359 GAGGAGAAGGAAAATCAGTGAGG - Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043014580 8:74922075-74922097 GAGGAGGAGGAAGAGGAGGAAGG - Intergenic
1043499475 8:80838567-80838589 GAGGAGGAGGAAAAGGGGGGAGG + Intronic
1043543901 8:81294244-81294266 GAAGAGGAGGAAACTGAGGCAGG - Intergenic
1043746939 8:83886196-83886218 AAGGAGATGGAAAGGGAGGCAGG + Intergenic
1044395891 8:91711392-91711414 GAGGAAGAGGAAAAGGAGGAAGG + Intergenic
1044422558 8:92014724-92014746 GAGGAGGAGGAAGAAGAGGAAGG + Exonic
1044949554 8:97422264-97422286 GAGGGTTATGAAAATGAGGCTGG + Intergenic
1045204194 8:100020178-100020200 AAGGAGAAGAAAATTGCGGCCGG - Intronic
1045800460 8:106095590-106095612 GAGAAGAAGGCTAATGAAGCTGG - Intergenic
1046001543 8:108426423-108426445 GAGGATGAGGAAATAGAGGCAGG - Intronic
1046168256 8:110469128-110469150 GATTAAAAGGAAAATGAGACAGG - Intergenic
1046218327 8:111179571-111179593 GAGGAGTAGCCAAATGAGGCTGG + Intergenic
1046339629 8:112836234-112836256 CAGGAGAAGAAAAATGGGTCTGG + Intronic
1046376785 8:113393604-113393626 CTGGAGAAGGAAAATGAGAAAGG + Intronic
1046605318 8:116365358-116365380 GATGAGATGGAAAAAGAAGCAGG - Intergenic
1046945308 8:119968860-119968882 GAGAAAAAGTAAGATGAGGCTGG + Intronic
1047221538 8:122922608-122922630 GAGGAGAAGGAACAGGAGGAAGG - Intronic
1047919786 8:129622982-129623004 AAGGAGAAAGAACATGAGACTGG + Intergenic
1048007638 8:130432027-130432049 AAGGAGGGGGAAAATGAGGTGGG + Intronic
1048182891 8:132212749-132212771 GAGGTGAAGCAGAGTGAGGCGGG - Intronic
1048323023 8:133416358-133416380 CAGGAGCAAGAAAGTGAGGCAGG - Intergenic
1048581170 8:135730945-135730967 GGAGGGAAGGAAAAGGAGGCAGG - Intergenic
1048606153 8:135970916-135970938 GAGGAGAAGGAAGGTAAGGCAGG - Intergenic
1048655317 8:136530226-136530248 GAGGGGCTGGAAAATGAGGTGGG - Intergenic
1048688674 8:136933674-136933696 GAGGGCTAGGAAAATGAGTCTGG - Intergenic
1048688711 8:136934157-136934179 GAGGGCTAGGAAAATGAGTCTGG + Intergenic
1048706347 8:137157356-137157378 GAGGAAAAGGAAAATTATGTAGG - Intergenic
1048996374 8:139796097-139796119 GAGGAGGAGGAAGAGGAGGAGGG + Intronic
1049816676 8:144606347-144606369 GAGGAGAAGGAAGAGGAAGGGGG - Intergenic
1050128393 9:2383473-2383495 CAGGAGCAAGAAAATGAGGGAGG + Intergenic
1050302206 9:4271034-4271056 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1050350152 9:4733723-4733745 GAGGAGAAATAAGATGAGGCTGG - Intronic
1050475935 9:6041080-6041102 GAGAAGAAGGAGGATGAGGAAGG - Intergenic
1050600110 9:7241982-7242004 GAGGAGGAGGAAGAAGAGGAGGG - Intergenic
1050611150 9:7355137-7355159 GAGGGGTAGGAAAAAGAGGCAGG - Intergenic
1050710461 9:8456342-8456364 GAGAGGACAGAAAATGAGGCAGG + Intronic
1050744193 9:8857928-8857950 GAGGAGGAGGAAAAGGGGGTAGG - Intronic
1050766473 9:9141095-9141117 GAGGAGAAGGAAGAAGAGAAGGG - Intronic
1050867370 9:10519888-10519910 GAGGAGAGGGAAATTGATGGGGG - Intronic
1051133093 9:13884510-13884532 GAGAAAAAGAAAAATGAAGCAGG - Intergenic
1051325780 9:15966388-15966410 GAGGAAATGGTAGATGAGGCTGG + Intronic
1051544672 9:18260570-18260592 GAGGAGAAAGAAAATCCAGCTGG + Intergenic
1051562891 9:18462640-18462662 TAGAAGAAGGAAAAAGGGGCCGG + Intergenic
1051800319 9:20925381-20925403 GAGGAGAAAGTAAGAGAGGCTGG - Intronic
1051919094 9:22243219-22243241 GATGGGAAGGATAATGAGGAAGG + Intergenic
1052311202 9:27071408-27071430 AAAGAAAAGTAAAATGAGGCTGG + Intergenic
1052425882 9:28303844-28303866 AAGGAGATAGAAAAGGAGGCAGG + Intronic
1052515964 9:29480156-29480178 AAGGAAAAGGAAAATAAGGAGGG - Intergenic
1052538767 9:29779813-29779835 GAGGAAAAGGAAGATGAGCGTGG - Intergenic
1052538875 9:29780644-29780666 GTGGGGAGGGAAACTGAGGCAGG - Intergenic
1052786364 9:32831829-32831851 GAGGAGAAGGAAGACAAGGCAGG + Intergenic
1052811518 9:33065037-33065059 GAAGAAAAGTAAAATGTGGCCGG - Intronic
1052838820 9:33273454-33273476 CAGGAAAAGGATAATTAGGCAGG - Intronic
1052840797 9:33289636-33289658 GAAGAGAAGGAAAAAGCAGCAGG - Intergenic
1053052221 9:34971467-34971489 GAGGAGAAGGAAGCAGAAGCAGG + Exonic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053450690 9:38191985-38192007 GGGGAGAAGGGAAAGGAGGCTGG - Intergenic
1054911699 9:70460921-70460943 GAAGAGTGGGAAACTGAGGCAGG + Intergenic
1054943929 9:70774236-70774258 GAGGAGGAGGAAGAAGAGGAGGG - Intronic
1054957968 9:70935046-70935068 GAAGTGATGGAAGATGAGGCTGG - Intronic
1054991475 9:71331964-71331986 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1055023989 9:71699756-71699778 GAGGAGATGGAAAAAGAAGTGGG - Intronic
1055074575 9:72200363-72200385 GAGGAGGAGGAAGAGGAGGAGGG - Intronic
1055280496 9:74668744-74668766 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1055411476 9:76034501-76034523 GAGGAGGAGGAAGAAGAGGAGGG - Intronic
1055760767 9:79605014-79605036 GAGGAGGAGGAAGAAGAGGAGGG + Intronic
1055838106 9:80469255-80469277 GAGGAGGTGGAACAGGAGGCAGG - Intergenic
1056454952 9:86751161-86751183 GAGGAGGAGGATACAGAGGCTGG + Intergenic
1056697695 9:88873921-88873943 CAGGACAAGGAGAATGAAGCAGG - Intergenic
1056710700 9:88990502-88990524 GAGGAGGAGGAAAAGGAGAGAGG - Intergenic
1056739976 9:89246082-89246104 CATAAGAAGGCAAATGAGGCTGG + Intergenic
1056832869 9:89930903-89930925 GAGAAGAAGGGACATGAGGGAGG + Intergenic
1056842205 9:90007423-90007445 AAGCAGAAGGAAAATCAGGCAGG - Intergenic
1056941509 9:90960425-90960447 GAGGAGCAGGACCATGAGTCAGG + Intergenic
1056959624 9:91111585-91111607 GAGGAGAAGGAAAGAGATGGGGG + Intergenic
1057059420 9:91990229-91990251 GAGGAGGAGGAAGAAGAGGAAGG + Intergenic
1057435500 9:95036648-95036670 GAGGAGGAGGAAGAAGAGGAGGG - Intronic
1057480234 9:95439557-95439579 GAGGAGAAGCAAGACAAGGCAGG - Intergenic
1057522366 9:95770220-95770242 GAGGACAAGGAAAACGAGATGGG - Intergenic
1058037468 9:100268484-100268506 GAGGGCTACGAAAATGAGGCTGG - Intronic
1058553224 9:106138125-106138147 GAGGAGGTGGAAGGTGAGGCAGG - Intergenic
1058608231 9:106746473-106746495 GAAAAGAAGGAAAATGAAGCAGG + Intergenic
1058715963 9:107722206-107722228 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1059067157 9:111097408-111097430 GTGAAGAAGGGAAAGGAGGCTGG - Intergenic
1059335361 9:113565414-113565436 GAGGAGGAGGAAGAGGAGGAGGG + Intronic
1059350461 9:113660643-113660665 GATGAGATGGAAAAGGAGGTAGG + Intergenic
1059561472 9:115338830-115338852 AAGGAGAAGGGAAATGTGGAAGG - Intronic
1059603580 9:115808715-115808737 GAAGAAAAGGAAAATAAGGAAGG - Intergenic
1059663096 9:116420812-116420834 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1059710669 9:116865025-116865047 GAGGAGAGGGTAAATGTGGCTGG - Intronic
1060183210 9:121547914-121547936 GTGGAGAAGGGAGATGGGGCAGG - Intergenic
1060237256 9:121873611-121873633 GAGGAGGAGGAGGAGGAGGCGGG - Intronic
1060381534 9:123179022-123179044 GAAGTGAAGAAAGATGAGGCCGG - Exonic
1060625148 9:125105494-125105516 GTGGAGAAGGGACATGAGACAGG - Intronic
1060705204 9:125792371-125792393 GAGGTGAAGGAAAATGAGAATGG + Intronic
1060727559 9:126016416-126016438 GAGGAGACGGCAGATGAGGAAGG + Intergenic
1060733750 9:126053414-126053436 AAGGAGAAGGAAATTGAGATGGG - Intergenic
1060735733 9:126065549-126065571 GAGGAGGAGGGAAAGGAGGGAGG - Intergenic
1060779866 9:126403432-126403454 GAGAAGAAGGAAAACGACGCAGG - Intronic
1060926456 9:127458831-127458853 TTTGAGAAGGAAAATGAGGCGGG + Intronic
1060989795 9:127841892-127841914 TTGGAGAAGGAAACTGAGGCTGG - Intronic
1061282020 9:129602885-129602907 GAGGAGGGGGAGAATGAGGGAGG + Intergenic
1061370730 9:130196007-130196029 GAGGAGGGGGAAAATGGGCCGGG + Intronic
1061559569 9:131394014-131394036 GAGGAGGAGGACGAGGAGGCGGG + Intergenic
1061783235 9:133008001-133008023 GAGGAGAAGGAAAGGGAGATGGG - Intergenic
1061783243 9:133008027-133008049 GAGGAGAAGGAAAGGGAGATAGG - Intergenic
1061943973 9:133898168-133898190 ACAGAGAAGGAAACTGAGGCCGG + Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062348644 9:136127873-136127895 GAGGAGGAGGAGGAGGAGGCTGG + Intergenic
1062377897 9:136272178-136272200 CAGCAGAAGGAAAAGGATGCGGG + Intergenic
1062478996 9:136742894-136742916 GAGGAGGGTGAAGATGAGGCAGG - Exonic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1203732257 Un_GL000216v2:101204-101226 GAGGAGGAGGAAAAAACGGCTGG + Intergenic
1185499223 X:584636-584658 GAGGAGAAGGGAGAGGAGGAGGG + Intergenic
1185504960 X:625187-625209 GAGGAGAAGGAGGAGGAGGAGGG - Intronic
1185563571 X:1079249-1079271 GTAGAGTAAGAAAATGAGGCTGG - Intergenic
1185717788 X:2356667-2356689 GAGGAGAAGGAGGAAGAGGGAGG - Intronic
1185830102 X:3293293-3293315 GAGGAGGAGGAGGATGAGGCAGG + Intergenic
1185870501 X:3660899-3660921 GAGGGGAAGGAAGAAGAGGTGGG + Intronic
1185948692 X:4406311-4406333 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1186011733 X:5142209-5142231 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
1186034468 X:5406127-5406149 GAGGAGGAGGAAGATGAAGGAGG + Intergenic
1186040014 X:5465599-5465621 GAGGAGGAGGAAGAAGAGGAGGG - Intergenic
1186047291 X:5550339-5550361 GAGGAGAAGGAAAAGAAGAAAGG - Intergenic
1186161652 X:6783009-6783031 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1186178422 X:6949371-6949393 GAGGAAAAGGATAAGGAGGAGGG - Intergenic
1186205710 X:7197794-7197816 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
1186291138 X:8100241-8100263 GAGAAGAGAGAAAATGAGGGAGG + Intergenic
1186576759 X:10775088-10775110 GAGGAGAATGAAAAAGAGGGAGG + Intronic
1186590120 X:10921408-10921430 GAGGAGAAATAAAAGGAGGGAGG - Intergenic
1186643765 X:11484348-11484370 GAGGAGGAGGAAGAAGAGGAAGG + Intronic
1186730227 X:12402117-12402139 GAGGAGAAGGAGGAAGAGACTGG + Intronic
1186788035 X:12971585-12971607 GAGAAGAAGGAAGAGGAGGGAGG - Intergenic
1187196751 X:17093660-17093682 GAGGAGAAAGATAATGGGGGAGG - Intronic
1187220949 X:17325266-17325288 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
1187447672 X:19373147-19373169 GAGAGGAAGGAAAAGGAGGAAGG + Intronic
1187617832 X:21017324-21017346 GAGGTGAAGGAAAATCAGCATGG - Intergenic
1187634271 X:21210076-21210098 CAGGAGAAAGAGAATGAGGGCGG - Intergenic
1187825898 X:23333697-23333719 GAGGAGGAGGAAGAGAAGGCAGG + Intergenic
1187847454 X:23555381-23555403 GGGGAGTAGGAAAGTGAGACTGG - Intergenic
1188269297 X:28118878-28118900 GGGAAGAAGGAAAAGGAGGAGGG - Intergenic
1188276277 X:28205566-28205588 AATGAGAGGGAAAATGAGGGAGG - Intergenic
1188435482 X:30153661-30153683 CAGGAGCGGGAAAATGAGACAGG - Intergenic
1188559173 X:31448273-31448295 GATAAAAAGGAAAAGGAGGCAGG + Intronic
1188660948 X:32757953-32757975 GAGGAGGAGGAAGAGGAGGGAGG + Intronic
1188955095 X:36424831-36424853 CATAAGAAGGAAAATGAGGTTGG + Intergenic
1189164233 X:38844288-38844310 GAAGAGAAGGAACCTAAGGCAGG - Intergenic
1189229276 X:39439525-39439547 GCGGAGTAGGAAAATGAGACAGG + Intergenic
1189229691 X:39442637-39442659 GAGGTGAAGGAAAATGAAGCAGG - Intergenic
1189264092 X:39700315-39700337 GAGGAGTAGGGAGGTGAGGCAGG + Intergenic
1189341026 X:40204692-40204714 AAAAAGAAGGAAATTGAGGCTGG - Intergenic
1189351437 X:40278716-40278738 CACAAGAAGGAAAATGGGGCTGG + Intergenic
1189591851 X:42521306-42521328 GAGGAGTAGGGAAATGAGACAGG + Intergenic
1189713601 X:43841376-43841398 AACAAGAAGGAAAATTAGGCAGG + Intronic
1190073838 X:47300976-47300998 GAGGAGGAGGAAAAAGGGGAAGG + Intergenic
1190094392 X:47467152-47467174 GAGGAGAGGGAGAATGTGGAAGG - Intronic
1190172628 X:48123698-48123720 AAGGAAAAAGAAAATCAGGCAGG - Intergenic
1190212508 X:48459602-48459624 GGGGAGGATGAAGATGAGGCTGG + Exonic
1190329270 X:49225857-49225879 GGGTAGAAGGAATAGGAGGCTGG + Intronic
1190718797 X:53129383-53129405 AAGAAGAAGAAAAATCAGGCTGG - Intergenic
1190795036 X:53733053-53733075 GAGGAGGAGGAAGAAGAGGGGGG - Intergenic
1191676287 X:63795359-63795381 GAGGAGAAGGGAAAGAAGGAAGG + Intergenic
1191697114 X:64001444-64001466 GAGGGCTAGGAAAATGAAGCTGG + Intergenic
1191909764 X:66136887-66136909 AAGGAGAAGGACTAGGAGGCTGG - Intergenic
1192033861 X:67543928-67543950 GAGGGGAGGGAAAAGGAGGTGGG + Intergenic
1192141497 X:68650446-68650468 GAGGAGGAGGAAGAGGAGGAGGG + Intronic
1192809769 X:74537536-74537558 GAGGAGGTGGCAAATGCGGCAGG - Intergenic
1193083890 X:77431011-77431033 GAAGAGAAGAGAAGTGAGGCAGG - Intergenic
1193120547 X:77818764-77818786 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
1193221403 X:78930611-78930633 GAGGAGAGAGAAAATGAGGAGGG - Intergenic
1193239584 X:79151669-79151691 GGTGAAAAGGAAAAGGAGGCGGG + Intergenic
1193254557 X:79331852-79331874 GAGAATAGGGAAAATGAGGCAGG - Intergenic
1193332204 X:80247178-80247200 GAGGAGAAGGTAATAAAGGCAGG - Intergenic
1194113733 X:89871139-89871161 GAGAAGAAGAAAAATTAGGCAGG - Intergenic
1194267367 X:91771462-91771484 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1194323266 X:92478351-92478373 GAACTGAAGGAAAATGAGACAGG - Intronic
1194795505 X:98207360-98207382 GAGGAGATGGAAGGGGAGGCAGG - Intergenic
1195457564 X:105085988-105086010 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1195457844 X:105089524-105089546 TAGGGGATGGAAAATGAGGTGGG - Intronic
1195692087 X:107635351-107635373 GAGGAGAATGAAAGTCAGGCAGG - Intronic
1195923724 X:110005058-110005080 GAGGAGGAGGAAGAGGAGACTGG + Intronic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196492836 X:116289120-116289142 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1196493351 X:116293700-116293722 GAGGGTTAGGAAAATGAGGCTGG + Intergenic
1196703380 X:118695882-118695904 AAGGAAAATGAAAATGAAGCCGG + Intergenic
1196918156 X:120560765-120560787 GACGAGAAGGAAAGTGAAGGGGG + Intronic
1196964184 X:121037817-121037839 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1196975162 X:121151184-121151206 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1196975705 X:121155487-121155509 GGGGGCTAGGAAAATGAGGCTGG + Intergenic
1197856292 X:130917092-130917114 GAGGAGAGGGGAAGTGAAGCTGG + Intergenic
1197872104 X:131070372-131070394 GATGAGAAGGGGGATGAGGCAGG + Intronic
1198237303 X:134747345-134747367 GAAGAGAAGATAAATGAGGAGGG + Intronic
1198250593 X:134875886-134875908 GTGAGGAAGGAAAATGAGACAGG + Intergenic
1198444826 X:136702001-136702023 AAGAATAAGAAAAATGAGGCCGG - Intronic
1198791355 X:140350188-140350210 GTAGAGAAGAAAAATGAAGCAGG - Intergenic
1198871537 X:141180930-141180952 AAGGGGAAAGAAAATGAGGAAGG - Intergenic
1198935190 X:141896806-141896828 GAGGACAAGGAAGAGGAGGAGGG - Intronic
1199393603 X:147308997-147309019 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1199590749 X:149466286-149466308 GAGGAGGTGGAAAGGGAGGCAGG - Intergenic
1199701887 X:150385632-150385654 GAGGAGAAGGAGGAAGAGGAAGG + Intronic
1199896900 X:152135454-152135476 GAGGAGGAGGGAAAAGAGGATGG + Exonic
1199987214 X:152961388-152961410 GACCAGAGGGAAACTGAGGCTGG - Intronic
1199991570 X:152990292-152990314 GAGGAGTTGGGAAACGAGGCAGG - Exonic
1199996669 X:153030481-153030503 GAGGAGTTGGAAAATGAGGATGG + Intergenic
1200112107 X:153745639-153745661 CAGGGGAAGGAAAATGTGGCGGG + Intergenic
1200371806 X:155734319-155734341 GAGGAGAAGGAAAGAGATGAGGG + Intergenic
1200466411 Y:3526177-3526199 GAGAAGAAGAAAAATTAGGCAGG - Intergenic
1200584572 Y:4992399-4992421 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1200631368 Y:5591512-5591534 GAACTGAAGGAAAATGAGACAGG - Intronic
1200793543 Y:7320244-7320266 GAGGGGAAGGAAGAAGAGGTGGG - Intergenic
1201247911 Y:12024662-12024684 GAGGAGGAGTAAAAAGAGGAGGG - Intergenic
1201271077 Y:12254134-12254156 GAAGAGAAGGAAAAGGTGGGAGG + Intergenic
1201942440 Y:19474326-19474348 GAGGAGAAGGGAAAGGAGTGTGG + Intergenic
1202093666 Y:21221255-21221277 GAGGAGGAGGAAGAGGTGGCAGG - Intergenic