ID: 1138242345

View in Genome Browser
Species Human (GRCh38)
Location 16:55437250-55437272
Sequence CTGTGTGAGTAAATGGATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 241}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138242345 Original CRISPR CTGTGTGAGTAAATGGATTT AGG Intronic
902536199 1:17120396-17120418 CTGTGTGAGGAAGTGGTCTTTGG + Intergenic
902798807 1:18816826-18816848 ATGTTTGAGAAAATGGACTTTGG - Intergenic
906582423 1:46947071-46947093 CTGTCTTTGTAGATGGATTTTGG - Intergenic
907602736 1:55787184-55787206 CTGTCTTTGTAGATGGATTTTGG + Intergenic
908495783 1:64693410-64693432 CTGTGTTAGGAAATTGATTGAGG + Intergenic
908670192 1:66537863-66537885 CTTTGTGGTTAAATGGATGTAGG - Intronic
908926648 1:69263743-69263765 CTGGGTGTGCAAATGGAATTAGG - Intergenic
910187046 1:84555309-84555331 CTTTTTGAATAATTGGATTTAGG - Intronic
911792304 1:102032926-102032948 CTGTGTGAGGAGATGGATGCAGG + Intergenic
912244766 1:107949723-107949745 CTGTGTGTGTACATGTACTTTGG - Intronic
912281154 1:108315717-108315739 GTGGGAGAGTAAATGGATTGAGG + Intergenic
912623293 1:111187491-111187513 CAGAGTGAGGATATGGATTTTGG + Exonic
913470587 1:119181966-119181988 CTGTCTTTGTAGATGGATTTTGG + Intergenic
913689347 1:121264066-121264088 CTGTGTGAGTCAGAAGATTTGGG - Intronic
914148250 1:145016205-145016227 CTGTGTGAGTCAGAAGATTTGGG + Intronic
914315238 1:146504701-146504723 CTGTGTTAGTCAATGGAATGGGG - Intergenic
914499117 1:148228675-148228697 CTGTGTTAGTCAATGGAATGGGG + Intergenic
914815416 1:151059112-151059134 CTGTGTGATTGAATATATTTGGG - Exonic
915233614 1:154464465-154464487 TTTTTTAAGTAAATGGATTTGGG + Intronic
915730896 1:158053551-158053573 ATGTGGGAGTAAAGGGATTCTGG - Intronic
918321325 1:183367671-183367693 CTGTTTCAGTAAAAAGATTTGGG + Intronic
918581179 1:186131755-186131777 CTGTGTGTGTAAATTTATGTAGG - Intronic
918775240 1:188620417-188620439 CTGTGGAAGTAAATGGAACTGGG + Intergenic
919492257 1:198219521-198219543 CAGTGTGAGTTAATGGACATTGG + Intronic
920228076 1:204452220-204452242 CTGTATGAGTAAAGGGTTTAAGG + Intronic
920476673 1:206282543-206282565 CTGTGTGAGTCAGAAGATTTGGG - Intronic
924506042 1:244684869-244684891 CTCTGGGATTAAATAGATTTGGG + Intronic
1064015284 10:11766884-11766906 GTGTGTGTGTAAATAGTTTTTGG + Intergenic
1066807263 10:39271403-39271425 CTGTCTGAGAAAATGCATTGTGG - Intergenic
1067742913 10:48910029-48910051 CTGTGTGTGAAAATGACTTTGGG - Exonic
1067996866 10:51283034-51283056 ATGTGTAAGTAAAAAGATTTTGG - Intronic
1068392934 10:56422852-56422874 CTGTGGAAGTAACTGGATTCTGG + Intergenic
1069274516 10:66572534-66572556 CTGTGTGGCTAATTGCATTTAGG + Intronic
1071263059 10:83938572-83938594 CTGTCTGGGTAAATAGATGTGGG - Intergenic
1072078947 10:92008880-92008902 CTGTGTGATGACATGGGTTTAGG + Exonic
1073588547 10:104734084-104734106 GTGTGTGAGTAGATGTATGTTGG + Intronic
1074088885 10:110228122-110228144 ATTTGTGGGTCAATGGATTTGGG + Intronic
1074863800 10:117533284-117533306 GTGTGTGTGTGAATGTATTTGGG - Intergenic
1076617966 10:131769414-131769436 CTCTCTAAGTAAATGGATATTGG + Intergenic
1078033037 11:7773017-7773039 CTAGTTGAGTAACTGGATTTGGG + Intergenic
1078160668 11:8837224-8837246 CTGTCTGAGTAAGTGTATTTGGG + Intronic
1078447884 11:11418474-11418496 CTTGGTGATTGAATGGATTTGGG - Intronic
1079819069 11:25102153-25102175 CTGTGTAATTGAATGGTTTTTGG + Intergenic
1080262784 11:30367809-30367831 CTGTGTGATCAAATAAATTTAGG + Intergenic
1080382838 11:31791704-31791726 CTCTCTGAGCATATGGATTTTGG - Intronic
1080862669 11:36163490-36163512 CAGTGTAGGTAAATAGATTTCGG + Intronic
1080873845 11:36259436-36259458 GTGAGTGAGTGAATGGACTTAGG - Intergenic
1087795194 11:102449146-102449168 TTGTGTGGGTAAATGAATTTTGG - Intronic
1089080204 11:115769795-115769817 CTGTGTGGGGGAATGAATTTAGG - Intergenic
1091057828 11:132435482-132435504 CAGTGTGGGAAAATGGAGTTAGG + Intronic
1091172735 11:133532705-133532727 CTGTGTGAGTATGTTGATGTGGG + Intergenic
1091683858 12:2547543-2547565 CTGTGTGTGTAAATGCGTGTGGG + Intronic
1093232956 12:16570611-16570633 CTGAGTGAGTAAGTGGCTCTTGG - Intronic
1093298635 12:17425285-17425307 CTGTGTCATTAAATGTATTGTGG + Intergenic
1093789113 12:23226473-23226495 ATGTGTGAGTAAATGAATAAAGG - Intergenic
1093991970 12:25599872-25599894 CTGAATCAGTAAATGGCTTTGGG - Intronic
1101177467 12:102169505-102169527 CTTAGTGAGTGAATGTATTTAGG - Intronic
1101841986 12:108334333-108334355 CTGTGTGAATAAATGCATGTGGG - Intronic
1102724279 12:115045248-115045270 CTGTGTGAGGGAAGGGATTTTGG + Intergenic
1102842840 12:116144444-116144466 TTTTGTGAGGAAATAGATTTGGG - Intronic
1106487689 13:30186979-30187001 TTGTTTGATTAAATGGCTTTGGG + Intergenic
1107064909 13:36202804-36202826 CTGTATGAGAAAACAGATTTGGG + Intronic
1110743240 13:79021901-79021923 CTGTGTGGGAAAACAGATTTTGG - Intergenic
1111344970 13:86940030-86940052 TTGAGTGAGTAAATAGACTTTGG - Intergenic
1111780812 13:92721423-92721445 CTTAGAGAATAAATGGATTTTGG - Intronic
1112042105 13:95556787-95556809 CTGTGCTAGTTGATGGATTTAGG - Intronic
1113198884 13:107842183-107842205 ATCTGTGAGTATATGGATTTTGG - Intronic
1114073482 14:19133198-19133220 CTGTGTGGCTAGATGCATTTCGG + Intergenic
1114088783 14:19266785-19266807 CTGTGTGGCTAGATGCATTTCGG - Intergenic
1114906056 14:27127979-27128001 CTCTATGAGTAAATGGGTGTGGG - Intergenic
1115260993 14:31453782-31453804 ATTTGTAAGTAAATGGATTAGGG - Intronic
1116187241 14:41611924-41611946 CTCTGTCATTAAATGGATTTTGG + Intronic
1116811498 14:49543965-49543987 CTGTGTGAATAAAGGGCGTTGGG + Intergenic
1117668301 14:58079937-58079959 CTATCTGAGTAACTGGATTATGG + Intronic
1118311341 14:64695619-64695641 CTATTTGAGTATATGGATTCTGG + Intergenic
1118658952 14:67986042-67986064 CTGTGTGTGTATGTGCATTTGGG + Intronic
1119035218 14:71224233-71224255 CTTTGTGAATATATGTATTTTGG + Intergenic
1119520936 14:75284612-75284634 CTGAGTGAGTAAAAGGGATTTGG - Intergenic
1120048414 14:79835781-79835803 CTGTGCAAGTATAAGGATTTAGG + Intronic
1120132745 14:80825719-80825741 CTGTATGAAAAAATGAATTTTGG - Intronic
1121082416 14:91119076-91119098 CTTTTTGAGCAAATGTATTTTGG - Intronic
1121443735 14:93965610-93965632 CTGTGTGGGTCAATGGTTCTTGG + Intronic
1123940781 15:25215669-25215691 CTGACAGAGTAAATGTATTTTGG + Intergenic
1125077161 15:35632946-35632968 CTTTTTGAGAAAATGGTTTTGGG + Intergenic
1126976130 15:54183590-54183612 CTATGTGAGTAAATTTCTTTTGG - Intronic
1129196726 15:73972945-73972967 GTGTGTGTGTGAATGCATTTGGG + Intergenic
1129987348 15:79929813-79929835 TTGAATGAGTGAATGGATTTAGG + Intergenic
1130331056 15:82922749-82922771 CTGAGTGAGGACTTGGATTTTGG - Intronic
1130913357 15:88285889-88285911 GTGTGTGAGTGAATGAATATAGG - Intergenic
1131619833 15:94056232-94056254 CTGTGAGTGTCAATGTATTTGGG + Intergenic
1133317074 16:4891610-4891632 CTGTGTGACTTACGGGATTTCGG - Intronic
1133614942 16:7467515-7467537 ATGGGTGAGAACATGGATTTTGG + Intronic
1134794602 16:17023515-17023537 CAGTGTCAGTAAGTGAATTTGGG + Intergenic
1136411822 16:30082187-30082209 CTGTGTTAGTAACTTGATTCTGG + Intronic
1137832048 16:51553243-51553265 CTGTGGGAATTAATGGAATTTGG + Intergenic
1138242345 16:55437250-55437272 CTGTGTGAGTAAATGGATTTAGG + Intronic
1139670688 16:68491002-68491024 CTGTGTGCGTAAATAGATGGAGG + Intergenic
1140079771 16:71734768-71734790 CTGGGTGTCTAAATGGTTTTTGG - Intronic
1143693444 17:8590702-8590724 CTGTGTAAGTAAATGAATAAAGG - Intronic
1148097654 17:45064440-45064462 CTTTGAGAGGAAATGGTTTTGGG + Intronic
1154957158 18:21270071-21270093 CTGTGTATGTACATGCATTTAGG + Intronic
1159688674 18:71457912-71457934 CTGTGAGAATAAATGGAGTGGGG - Intergenic
1162304107 19:9861039-9861061 CTGTGTGAGAGAATGAATTCTGG - Intronic
1163025620 19:14509823-14509845 CTGGGTGAGTTAGTGCATTTAGG - Intergenic
1167881065 19:52457702-52457724 CTCTGTGACTAAATGTATGTGGG - Intronic
1168413228 19:56153073-56153095 CTGTGTGAGCCACTGGAGTTGGG + Intronic
925551030 2:5074663-5074685 CTGTGTCAGTAGATGGAGGTTGG - Intergenic
928464270 2:31505884-31505906 ATGTGTGGTTAAATGCATTTGGG - Intergenic
928742314 2:34369599-34369621 CTGAGTGAAGAAATGGAGTTAGG + Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
932293887 2:70608485-70608507 CTGTGCAAGTAGATGGGTTTCGG - Intronic
935748551 2:106210557-106210579 CTGTCTTTGTAGATGGATTTTGG - Intergenic
936449898 2:112626171-112626193 CTATGTCAGAAAAGGGATTTTGG + Intergenic
939014718 2:136888973-136888995 GTGTGTGTGTACATGTATTTAGG + Intronic
939493888 2:142906120-142906142 CTGTCTCTGTAGATGGATTTTGG + Intronic
940995380 2:160143920-160143942 CTGTGTGGAAAAATGGGTTTTGG + Intronic
942397452 2:175566827-175566849 ATGTGTGAATACATGCATTTTGG + Intergenic
945564415 2:211378807-211378829 CTGTTTGTGTACATGGACTTCGG - Exonic
946820161 2:223620772-223620794 CTGTGAGAGTACATGTATTAAGG - Intergenic
948375238 2:237516743-237516765 CTCAGTGAGTAGATGGATTGTGG + Intronic
1170183319 20:13557902-13557924 ATGTGTGGGTGAATGAATTTAGG - Intronic
1173933763 20:46843892-46843914 CTGTCTGAGTAAATGTGTTTGGG + Intergenic
1173941712 20:46916382-46916404 GTGTGTGAGTATATGAATGTGGG + Intronic
1175155981 20:56971911-56971933 CTGAGGGAGTAACTGAATTTCGG + Intergenic
1175520684 20:59600753-59600775 CTGAGTCAGGAAATGGCTTTGGG + Intronic
1176292114 21:5051832-5051854 ATGTGTGAGTAAGTGAATGTGGG - Intergenic
1176330818 21:5547101-5547123 CTGTGTCAGCAAATGGCTCTGGG + Intergenic
1176396939 21:6273850-6273872 CTGTGTCAGCAAATGGCTCTGGG - Intergenic
1176440218 21:6715254-6715276 CTGTGTCAGCAAATGGCTCTGGG + Intergenic
1176464480 21:7042323-7042345 CTGTGTCAGCAAATGGCTCTGGG + Intergenic
1176488041 21:7424102-7424124 CTGTGTCAGCAAATGGCTCTGGG + Intergenic
1177947638 21:27491952-27491974 TTTTGTCTGTAAATGGATTTGGG - Intergenic
1178364308 21:31975856-31975878 TTTTGTTAGCAAATGGATTTGGG + Intronic
1179280097 21:39926550-39926572 CTCTGGGAGTAGAAGGATTTGGG + Intronic
1179562216 21:42222870-42222892 CTGGGTGACTAAACTGATTTGGG - Intronic
1179865143 21:44211818-44211840 ATGTGTGAGTAAGTGAATGTGGG + Intergenic
1180491924 22:15855551-15855573 CTGTGTGGCTAGATGCATTTCGG + Intergenic
1183708571 22:39489401-39489423 CTCTGTAAGTAGATGCATTTGGG + Exonic
949726473 3:7052550-7052572 CTGTGTGTGTATATGGAGGTGGG - Intronic
950196308 3:11011445-11011467 GTGTGAGAGGAAATGGATTCAGG - Intronic
950443918 3:13025294-13025316 CTGTGTGAGTCACTGGACTGAGG - Intronic
951359316 3:21705738-21705760 ATGTGGGAGCAAGTGGATTTTGG - Intronic
952076584 3:29704197-29704219 CTGTGTGGGGAGATGGTTTTGGG - Intronic
954003453 3:47575672-47575694 CTGTGTGAGTGGCTGCATTTTGG + Intronic
954891609 3:53935516-53935538 CAGTGTGAGTAAATGTATGTAGG + Intergenic
956466446 3:69524889-69524911 GTGGGAGAGGAAATGGATTTGGG + Intronic
956592942 3:70934504-70934526 CTATGTGAGGAATAGGATTTGGG - Intergenic
958091387 3:88881108-88881130 CTGTGTGTTCAAATGGATATTGG - Intergenic
959207611 3:103331055-103331077 TTGTGAGACTATATGGATTTTGG + Intergenic
959447095 3:106453942-106453964 CTCTGTCAGTCATTGGATTTGGG + Intergenic
960244837 3:115388763-115388785 TTGTGTGACTGAATGGATTTTGG + Intergenic
961632086 3:128308507-128308529 CTGTGCGATTAAATGGCATTTGG - Intronic
964315715 3:155442278-155442300 GTGAGTGACTAAAAGGATTTGGG - Intronic
966068789 3:175849063-175849085 CTGGGTCAGTGAATGGCTTTTGG + Intergenic
966387912 3:179421202-179421224 CTGTGAGAGAAAAAGGAATTAGG - Intronic
967530480 3:190543855-190543877 ATGTGTGAGCAAATTGCTTTGGG + Intronic
968865870 4:3210876-3210898 CAATTTTAGTAAATGGATTTTGG - Intronic
969368882 4:6718186-6718208 TTGTGTGAGTGAATGGTATTAGG + Intergenic
972564799 4:40260129-40260151 CTGTGTTAGAAAATGATTTTGGG + Intergenic
972879233 4:43403475-43403497 CTGTGAAAGTAACTGGATTTAGG - Intergenic
973161747 4:47026766-47026788 CTGTATAATTAAATGCATTTAGG - Intronic
973306805 4:48661241-48661263 CTGAGGGAGTAACTGGAATTGGG + Intronic
975258364 4:72267117-72267139 CTGAGTCAGTGAATGGATATTGG + Intergenic
977222029 4:94349283-94349305 CTGTGTAACTAAAGAGATTTTGG - Intergenic
978743044 4:112160557-112160579 CTGTGAGTGTAAATAAATTTCGG - Intronic
979515080 4:121598419-121598441 CTTTGTAAATAAATGGACTTGGG + Intergenic
979611313 4:122691759-122691781 CTGGGTGGGTAAATTGAATTCGG + Intergenic
982347845 4:154380894-154380916 ATGTGTCAGTCAATGGATATTGG - Intronic
982474974 4:155839336-155839358 GTGTGTGTGTAAATGGATAGAGG - Intronic
983880001 4:172922445-172922467 CTGATAGAGTAGATGGATTTAGG - Intronic
984585983 4:181564814-181564836 CTGTGTGAGTCACTGGCATTAGG + Intergenic
984836264 4:184024703-184024725 CTGTGAGAGTTCTTGGATTTAGG + Intergenic
984957842 4:185063445-185063467 CTGTGTGAGTAAAAGAAACTTGG - Intergenic
985194452 4:187413333-187413355 GTGTGTGAGTACATGGGCTTGGG + Intergenic
985826501 5:2195514-2195536 CTGTTTTTGAAAATGGATTTTGG + Intergenic
985857781 5:2443622-2443644 CTGTGTGAGTTTATGGGTTATGG - Intergenic
985859136 5:2456585-2456607 CTGTGTGCTTATATGGATTGAGG + Intergenic
986162169 5:5239979-5240001 CTGTGTAAGTTAATGGCTGTTGG + Intronic
986645336 5:9911232-9911254 CAGTGTGAGGAAGAGGATTTAGG - Intergenic
988409102 5:30863677-30863699 GTGTATGAGAAAATGAATTTAGG + Intergenic
989819287 5:45775753-45775775 CTCTGTGAGTACATGTATATGGG - Intergenic
991200298 5:63984435-63984457 CTGTGTAAGGAATTGGGTTTAGG - Intergenic
993475714 5:88361714-88361736 TTCTGTGAGTAAATGGACTAGGG - Intergenic
994615349 5:102097888-102097910 ATGTGTGAGCATTTGGATTTGGG + Intergenic
995987499 5:118196659-118196681 CTCTTTGAGAAGATGGATTTAGG - Intergenic
997396330 5:133562883-133562905 CGGTTTGAGTAGATGAATTTTGG + Intronic
997722880 5:136094482-136094504 GTCTGTGAGAAAATGGTTTTGGG + Intergenic
998542769 5:142998497-142998519 CTGTGTTTGTAAATGTATGTTGG + Intronic
998744224 5:145238484-145238506 ATGTGTAAATAAATGCATTTAGG - Intergenic
999060932 5:148634295-148634317 CTGTGTTGGTAAATGGGGTTTGG - Intronic
999574256 5:152956908-152956930 ATGTGTGAATAAATTAATTTAGG + Intergenic
1000335907 5:160241376-160241398 CAGTGTGGGTAAATGGAGTAAGG + Intergenic
1000478115 5:161737663-161737685 CACTTTGAGTAAATGGATCTTGG + Intergenic
1000690519 5:164313458-164313480 CTGTGTGGTTAAATGGATTATGG + Intergenic
1001209035 5:169793196-169793218 CTGTGTAAGCATATGCATTTTGG - Intronic
1003012919 6:2442942-2442964 CTTTATGAGTAAATGGAATCAGG - Intergenic
1003169493 6:3709911-3709933 TGGTGTGATTAAAAGGATTTGGG - Intergenic
1004615400 6:17283122-17283144 CTGTGTGCAAAAATGGATCTTGG + Intronic
1008373119 6:50759122-50759144 ATGTGTGAATAATTGGCTTTGGG + Intronic
1008513425 6:52298084-52298106 CTGTGTGAGCAAAGGCAATTGGG - Intergenic
1009259878 6:61472174-61472196 CTGTTTGAGAAAATGCTTTTTGG + Intergenic
1011506054 6:88045351-88045373 CTGTGAGATAAAATCGATTTTGG - Intergenic
1013826943 6:114224048-114224070 TTGTGTTAGTAAATGCTTTTGGG + Intronic
1015198583 6:130552509-130552531 CTGGGTGAGGAAAGGGATATAGG - Intergenic
1015312587 6:131781754-131781776 TTGTGTGAATAAATATATTTAGG + Intergenic
1016187607 6:141217192-141217214 CTGTGTTGTTGAATGGATTTTGG + Intergenic
1017573757 6:155778562-155778584 CTCTGTGAGGAAATGGATTTGGG - Intergenic
1019729317 7:2621859-2621881 TTTGGTGAGTAAATGAATTTAGG - Intergenic
1023344312 7:39255716-39255738 CTGGGTGAGGAAAGGGATTTAGG + Intronic
1023959616 7:44915465-44915487 CTGTACCAGTAAATGGATTTGGG + Intergenic
1024421437 7:49171617-49171639 CAGTGTGACTATCTGGATTTTGG - Intergenic
1027332506 7:77114255-77114277 GTGTGTGAGTGACTTGATTTTGG + Intergenic
1027750813 7:82142993-82143015 CTGTGTGAATAAAAGAACTTAGG + Intronic
1028348107 7:89808543-89808565 CTATGCCAGAAAATGGATTTGGG + Intergenic
1028366948 7:90043258-90043280 TTTTATGAGTAAATGGTTTTGGG - Intergenic
1029783272 7:102757058-102757080 GTGTGTGAGTGACTTGATTTTGG - Intronic
1030545570 7:110890964-110890986 GTGTGTGTGTATATGTATTTGGG - Intronic
1030909747 7:115232356-115232378 CTGTGTTGGTAAATTAATTTGGG + Intergenic
1032486811 7:132293913-132293935 ATGGGTGACTAAATGGATCTGGG - Intronic
1032714816 7:134498475-134498497 CTAAGTGAGTGCATGGATTTGGG + Intergenic
1032725532 7:134587052-134587074 CTGTCTTTGTAGATGGATTTTGG - Intergenic
1033724502 7:144099760-144099782 CTTTGTTAGTAAGTGGATTAAGG - Intergenic
1034248969 7:149672915-149672937 CTGTCTTTGTAGATGGATTTTGG - Intergenic
1034604146 7:152295423-152295445 CTATGAGGGTATATGGATTTTGG - Intronic
1035368298 7:158362375-158362397 CTCTGTGAGTAAATGAGTTGTGG - Intronic
1036279771 8:7390878-7390900 CTGTGTGTGTAAATGGAGGTAGG - Intergenic
1036341748 8:7921005-7921027 CTGTGTGTGTAAATGGAGGTAGG + Intergenic
1038319902 8:26516321-26516343 CTGTGTGAGTACATTGAGTGAGG + Intronic
1040066199 8:43146122-43146144 CTGTGTGAGTTTCTGGATTGGGG + Intronic
1042018142 8:64340179-64340201 CTGTGGGAACACATGGATTTTGG - Intergenic
1042074613 8:64978221-64978243 CTGTGTGTGAAAATGCATTTTGG + Intergenic
1044608071 8:94064314-94064336 ATGTGGCAGTGAATGGATTTGGG - Intergenic
1044750991 8:95415298-95415320 ATAGGTGAGGAAATGGATTTAGG + Intergenic
1046142557 8:110113834-110113856 CTGAGAGACTAAATGGATTTGGG - Intergenic
1052101655 9:24454187-24454209 CTTTTTGAGTAAATTTATTTGGG + Intergenic
1052984635 9:34477711-34477733 CTGGGTGACTAAATGGATAGTGG + Intronic
1054363286 9:64201066-64201088 CTGTTTGAGAAAATGCTTTTTGG + Intergenic
1056804345 9:89717168-89717190 GTGTGTGAGTATATGTATGTGGG - Intergenic
1058207010 9:102120616-102120638 CTGTGTCACTAAATGGCTTCAGG - Intergenic
1060061675 9:120466310-120466332 CTGAGGGAGTAGATGGAGTTAGG - Intronic
1061620640 9:131809400-131809422 TTGGGTGAGTTGATGGATTTTGG + Intergenic
1186214029 X:7280149-7280171 CTGTGTGCTTAAATGTTTTTTGG + Intronic
1187659808 X:21530873-21530895 GTGTGTGAGTAATAGGTTTTAGG + Intronic
1188708661 X:33366371-33366393 CTGAGTGTGTAAATTGCTTTGGG + Intergenic
1188783547 X:34314821-34314843 ATGTTTGGGTAAATGCATTTGGG - Intergenic
1188942605 X:36259283-36259305 CTGTGTGAGAAACTGGCTTAGGG + Intronic
1191167292 X:57404331-57404353 CTGTCTTTGTAGATGGATTTTGG + Intronic
1191612377 X:63131492-63131514 CTGTTTGAGTCCAGGGATTTGGG - Intergenic
1191623920 X:63247434-63247456 CTGTTTGAGTCCAGGGATTTGGG + Intergenic
1192084240 X:68079869-68079891 CTTGGTGACTAAATGGATGTGGG - Intronic
1193076050 X:77356868-77356890 CTGTTTAAGTAACTGGACTTGGG - Intergenic
1193172184 X:78349139-78349161 CTGTCTTTGTAGATGGATTTTGG + Intergenic
1194768341 X:97869716-97869738 TTGTTTGAATAAATGAATTTAGG - Intergenic
1195262278 X:103144214-103144236 CCCTGTGGGAAAATGGATTTGGG + Intergenic
1197418653 X:126208535-126208557 CATTGTGAGCCAATGGATTTAGG + Intergenic
1197979152 X:132197573-132197595 CTGAGTGATTAAATGAATTTTGG - Intergenic
1198772569 X:140146428-140146450 CTGTGTGTGTATGTGGTTTTAGG - Intergenic
1199195849 X:145029546-145029568 CTGTGTTAATTAATGTATTTTGG - Intergenic
1200150829 X:153950613-153950635 CTGTGTTAGAAAATGGCTTATGG - Intronic
1200920430 Y:8608131-8608153 CTGTGTGAGTGTGTGGCTTTGGG + Intergenic
1201614647 Y:15883734-15883756 GTGTGTGAGTATATTCATTTTGG - Intergenic