ID: 1138244630

View in Genome Browser
Species Human (GRCh38)
Location 16:55458314-55458336
Sequence GGTTGTATTGGAGGACGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138244625_1138244630 15 Left 1138244625 16:55458276-55458298 CCTGTAGACAATGGGGAGCCAGT 0: 1
1: 0
2: 11
3: 50
4: 243
Right 1138244630 16:55458314-55458336 GGTTGTATTGGAGGACGAGATGG 0: 1
1: 0
2: 0
3: 6
4: 138
1138244627_1138244630 -3 Left 1138244627 16:55458294-55458316 CCAGTTCATGAGCATGAGTTGGT 0: 1
1: 0
2: 1
3: 37
4: 286
Right 1138244630 16:55458314-55458336 GGTTGTATTGGAGGACGAGATGG 0: 1
1: 0
2: 0
3: 6
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138244630 Original CRISPR GGTTGTATTGGAGGACGAGA TGG Intronic
906577028 1:46900321-46900343 GGTTGTACCAGAGGAGGAGATGG - Intergenic
906594936 1:47067582-47067604 GGTTGTACCAGAGGAGGAGATGG + Exonic
908773041 1:67613422-67613444 GGTTGTGTCGGTGGATGAGAAGG - Intergenic
908926626 1:69263117-69263139 GGTTGTACAGGAGTTCGAGAAGG + Intergenic
914900554 1:151709085-151709107 GGTTGAGATGGAGGAGGAGAGGG + Intronic
915896394 1:159814448-159814470 GGTGGTAGTGAAGGAGGAGATGG - Intronic
916259190 1:162823464-162823486 GGTTGTTTAGGAGCATGAGAAGG - Intergenic
917451729 1:175152841-175152863 GGTTGAATTAGAGAAGGAGAAGG + Intergenic
919943997 1:202306862-202306884 GGTTGTGTTGGAGGCCGCTAGGG - Exonic
921335948 1:214086514-214086536 GGTTGTGGTGGAGGATGAGAAGG - Intergenic
922324413 1:224514874-224514896 GGTAGTATGGGAGGCAGAGAAGG - Intronic
922769834 1:228175800-228175822 GGTTGTCTGGGAGGACGGGACGG + Exonic
923146444 1:231202046-231202068 GGTAGTCATGGAGGAGGAGATGG + Intronic
1068395734 10:56458768-56458790 GGTTGTAGAGGAGGAAGAGGAGG + Intergenic
1068897430 10:62222357-62222379 AGTTCTTTGGGAGGACGAGATGG - Intronic
1069538520 10:69274667-69274689 TGTTGTATTTGAGAAAGAGAAGG - Intronic
1069840351 10:71335782-71335804 GGTTGTTCTGGATGAAGAGACGG + Intronic
1073772936 10:106755261-106755283 TCTTTTATTGGAGGATGAGAAGG + Intronic
1074389504 10:113045070-113045092 GGGAGTATTGGAGGAGGAGCAGG + Intronic
1075548327 10:123373126-123373148 GGTTATATTGGAGGAAGAGGGGG - Intergenic
1076404307 10:130201876-130201898 GGGTGAATTTGAGGAGGAGAGGG + Intergenic
1076404332 10:130201955-130201977 GGGTGAATTTGAGGAGGAGAGGG + Intergenic
1076404372 10:130202075-130202097 GGGTGAATTTGAGGAGGAGAGGG + Intergenic
1077363051 11:2149311-2149333 GGTTGACGTGGAGGAGGAGAGGG + Exonic
1078332937 11:10440884-10440906 GGTGGTATTAGGGGACAAGAAGG + Intronic
1085208262 11:74749824-74749846 GGTTGAATTTGAGGATGTGAAGG + Intronic
1088824317 11:113481153-113481175 GATTGTGTTGGAGGAAGAGGGGG - Intergenic
1088898165 11:114093410-114093432 GAGTGTAGTGGAGGAAGAGAGGG - Intronic
1089200220 11:116720315-116720337 GGTTGAATTCGAGGAGGTGATGG + Intergenic
1089783901 11:120894535-120894557 GGTTGCAGTGAAGGAGGAGAAGG - Intronic
1091217201 11:133909441-133909463 GGTTGTCTTGGCGGAAAAGAAGG - Intronic
1094042698 12:26134281-26134303 GGTTGAGTAGGAGGAAGAGAAGG - Intronic
1100168522 12:91945938-91945960 GGTTTTTTTGGAGGAGGAAAAGG + Intergenic
1101161590 12:101982386-101982408 GGTTATATTGCAGAGCGAGATGG + Intronic
1101567311 12:105920324-105920346 GGTTGTGGTGGAGGAAGAAAGGG + Intergenic
1106574749 13:30964119-30964141 GGCTGTGTTGGAGGAAGAGGAGG - Intronic
1106704387 13:32265132-32265154 GGTTGGATTGGAGGTCTTGATGG + Intronic
1107071647 13:36276624-36276646 GGGTGTAGTGGAGGACAAGGGGG + Intronic
1113064371 13:106358691-106358713 GGTGGTTTTGGAGGATGGGAGGG - Intergenic
1114742759 14:25114959-25114981 GGTTATTTTGGGGGAAGAGAAGG + Intergenic
1115226321 14:31105816-31105838 GATTTTGTTGGAGGAGGAGAGGG - Intronic
1119234305 14:73006603-73006625 GGGTGAATTGGAGGGAGAGAGGG - Intronic
1120561161 14:85994564-85994586 GGTTTTATTGGATAACGTGAGGG - Intergenic
1127530402 15:59837963-59837985 GTTTGTGGTGGAGGATGAGATGG - Intergenic
1129860637 15:78858339-78858361 GGTTCTTTTGGAGGCCGAGGCGG + Intronic
1131356449 15:91750182-91750204 GGTGGAATTGGAGGAAGAGGTGG + Intergenic
1134686121 16:16159765-16159787 GGTTCTACTGAAGGAAGAGAGGG - Intronic
1138244630 16:55458314-55458336 GGTTGTATTGGAGGACGAGATGG + Intronic
1143436893 17:6935607-6935629 TCTTGTTTTGGAGGACTAGACGG + Intronic
1143632345 17:8146433-8146455 GGTGGTATAGGAGGAGGAGGAGG + Exonic
1145178358 17:20721889-20721911 GGATGTATGGGAAGAAGAGATGG - Intergenic
1146227622 17:31080345-31080367 AGTTGTTTGGGAGGACTAGAGGG + Intergenic
1149838003 17:59931476-59931498 GGATGTATTGGAAAAAGAGATGG - Intronic
1153348004 18:4049394-4049416 GGCTGCATGGGAGGAGGAGACGG - Intronic
1154172830 18:12063452-12063474 GGATTTATTGGAGGAACAGAGGG + Intergenic
1157953079 18:52062225-52062247 GGTTGAATGGAAGGACAAGAGGG - Intergenic
1159839934 18:73387337-73387359 GGATGTATGGGAGGAAGAAAAGG + Intergenic
1160910580 19:1472047-1472069 GGTTGTTTTGGGGGAAGAGGGGG + Exonic
1162537136 19:11269501-11269523 GGTGGGACTGGAGGACGAGCAGG + Intergenic
1165330315 19:35138400-35138422 GGCTGTTTTAGAGGACGGGAGGG - Intronic
1165503247 19:36206913-36206935 GGGAGTTTTGGAGGAAGAGAGGG + Intronic
1165866518 19:38942794-38942816 TGTTGAAGTGGAGGAAGAGAAGG - Intronic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
928505633 2:31949609-31949631 GGTTGGATAGGAGGTGGAGATGG + Intronic
933686037 2:85141855-85141877 GTGTGCATTGGAGGACCAGATGG + Intronic
940034131 2:149295494-149295516 GGTTGTTTTGGTGGAGTAGAAGG + Intergenic
942245531 2:174004452-174004474 GGTTGAATTGGAGTGAGAGAGGG - Intergenic
944499361 2:200342359-200342381 GGTGGTATTGGAGGAGGACCTGG + Intronic
947744992 2:232502909-232502931 GGTGGTGTTGGGGGAGGAGAGGG + Intergenic
1172515021 20:35527451-35527473 CATGGTATTGGAGGAAGAGAGGG + Intronic
1175183080 20:57162088-57162110 GGTTCTCATGGTGGACGAGATGG - Intergenic
1180017125 21:45094692-45094714 GGTTGGATGGGAGGACAGGAAGG - Intronic
1180137392 21:45870657-45870679 GGTTGACTGGGAGGACCAGAGGG + Intronic
1180631778 22:17234827-17234849 GGTTGTTTTGAAGGCGGAGATGG - Intergenic
1181840682 22:25657042-25657064 GGTTGTACTGCATGAAGAGAGGG + Intronic
1181880320 22:25974137-25974159 TGTTGTATTAGAGGAAGAAAAGG - Intronic
1182094694 22:27618146-27618168 GGTTATATTGGAGGAAGGGCTGG + Intergenic
1182693509 22:32180077-32180099 GGTTTAATTGTAGGACCAGAGGG - Intergenic
1183464473 22:37972800-37972822 GGTTGTAGTGGAGGAGGACTGGG + Exonic
1185013468 22:48330026-48330048 GGTTGTATTGGATGACATAAAGG - Intergenic
950080262 3:10216832-10216854 GGTGGCGTTGGAGGAGGAGAGGG + Intronic
952480606 3:33757428-33757450 AGTTGGATTGGAGAACAAGATGG - Intergenic
955493476 3:59506595-59506617 GGTTGTCTTGGAGAAGGAGAAGG + Intergenic
956287711 3:67628012-67628034 AGAAGTATTGGAGGACTAGAAGG - Intronic
956398406 3:68850099-68850121 GGTAGTATTTGAGGAAGAGGAGG - Intronic
957272981 3:78055334-78055356 TTTGGTATTGGAGGAGGAGAGGG - Intergenic
957840811 3:85666788-85666810 GGTTGTATGGCAGGAAGAAATGG + Intronic
960046612 3:113204658-113204680 GGGTGTCATGGAGGACGAAAGGG + Intergenic
961428759 3:126865171-126865193 GGTGGTAGTGGAGGAGGAGGAGG - Intronic
966831833 3:184017085-184017107 GGAGGTCTTGGAGGAGGAGATGG - Intronic
970078031 4:12247491-12247513 GGTAGTATTGAAGAACCAGAAGG + Intergenic
971126286 4:23758862-23758884 GGTTGTATTAGAGCACCAGGGGG - Intronic
971217112 4:24672004-24672026 GGTTGTATGGGAGCTCGAGGAGG + Intergenic
971288406 4:25312488-25312510 GGTTGTATTGTAGGTCCAAAAGG - Intergenic
976500501 4:85783140-85783162 AGTGGAATTGGAGGACAAGAAGG + Intronic
978955143 4:114603134-114603156 GGTGGTATAGGAGGATGGGATGG + Intronic
981792526 4:148554908-148554930 GACTGTATTGGAGGAGAAGATGG + Intergenic
986098063 5:4579926-4579948 GGGTGGATTGGAGGAGGAGTCGG - Intergenic
989766679 5:45093504-45093526 GTGTGTATTTGAGGACTAGATGG - Intergenic
995392742 5:111657039-111657061 GGTTGTGTTGGGGGATGAGAGGG - Intergenic
996125306 5:119719409-119719431 GGTTGAAGAGGAGGAAGAGAAGG - Intergenic
998139440 5:139691550-139691572 GGATGAATTGGAGGAGGACATGG + Intergenic
1002073956 5:176697169-176697191 GTTTGTTTTAGAGGAAGAGAGGG - Intergenic
1007964543 6:45991653-45991675 GCTTGTATTGGAGGAAGATGGGG + Intronic
1008154034 6:47991047-47991069 TGTTTGATTGGAGGACAAGAGGG + Intronic
1009319250 6:62266065-62266087 GGTGGTGTGGGAGGAGGAGATGG + Intronic
1009788554 6:68369644-68369666 GGTTGTATGGGAGGAGGGAATGG + Intergenic
1013520305 6:110926658-110926680 GGTTGTTTAGGAGAACTAGATGG - Intergenic
1016216728 6:141613134-141613156 GGTTGTATTTGAGGAAAACAGGG - Intergenic
1017943330 6:159072977-159072999 GGTGGTATTGGTGGAAGTGAGGG + Intergenic
1022068803 7:26889045-26889067 GGTATGATTGGAGGACGAAAGGG + Intronic
1022625525 7:32032242-32032264 GGTTATTTTGGAGGAGGAGGTGG + Intronic
1022865811 7:34418687-34418709 GTTTGTCCTGGAGGAGGAGAAGG - Intergenic
1023088014 7:36591733-36591755 GTTTCTATTGGGGGATGAGAGGG - Intronic
1025212823 7:57030698-57030720 GGGTGTTGAGGAGGACGAGAGGG - Intergenic
1025659130 7:63546126-63546148 GGGTGTTGAGGAGGACGAGAGGG + Intergenic
1029996673 7:105013767-105013789 GGTTGTTTGGGAGGGGGAGAAGG + Intergenic
1031968806 7:128048692-128048714 TTTTGTTTTGGAGGGCGAGACGG + Intronic
1033926249 7:146464601-146464623 TGTGGAATTGGAGGAGGAGAAGG - Intronic
1034987065 7:155522828-155522850 GGTTGTCTTGGAAAAAGAGAAGG - Intronic
1036034191 8:5001463-5001485 GGTTGTATGGCAGGTGGAGAAGG + Intergenic
1040557751 8:48496265-48496287 ACTTGTTTTGGAGGAGGAGAAGG - Intergenic
1041053536 8:53960118-53960140 GGATGTGTTGGAGGCAGAGAGGG + Intergenic
1041214137 8:55583083-55583105 GATTGTATTTGAGGACTAGGGGG - Intergenic
1042885956 8:73552055-73552077 GGTTGTACTGGAGAACAAGGGGG + Exonic
1049372372 8:142273963-142273985 GGCAGTATTGGCAGACGAGATGG - Intronic
1051684097 9:19639156-19639178 GGTTATTATGGAGGAGGAGAGGG - Intronic
1051763813 9:20499977-20499999 GGTGGTATTGAAGGAAGACAGGG - Intronic
1058666639 9:107324087-107324109 AGTTGTATTTGAGGAGGGGAAGG - Intronic
1059511415 9:114851668-114851690 GATTGGAATGGAGGAGGAGAGGG + Intergenic
1061847048 9:133393718-133393740 GGTTCTATTGGAGGTGTAGATGG + Intronic
1203652975 Un_KI270751v1:145956-145978 GGGTGTGTTGGAGGAAGAAAAGG + Intergenic
1186595579 X:10978329-10978351 AGTTCTCTTGGAGGAAGAGATGG + Intergenic
1187442395 X:19332111-19332133 GGGAGTATTGGAGGAACAGAAGG + Intergenic
1188418188 X:29963325-29963347 GGATGTATTTGAGGAAGAAAAGG + Intergenic
1190395473 X:49977633-49977655 GGTTGTATATGAGGACCATAAGG + Intronic
1191576946 X:62716381-62716403 GGTGGTATTGCAAGACCAGAAGG - Intergenic
1192483330 X:71503797-71503819 GGTGGTAGTGGAGGAGGAGGAGG - Intronic
1194127572 X:90039261-90039283 GGTTGTACTGGAGAACAAGGGGG + Intergenic
1197266615 X:124380860-124380882 TGTTGAATGGGAGGACTAGACGG - Exonic
1197832164 X:130654926-130654948 GGAGTTATTGGAGGAGGAGAGGG - Intronic
1197892807 X:131282807-131282829 GGGTGGTTTGGAGGAAGAGAAGG - Intronic
1198017199 X:132623439-132623461 GGTTGGGTTGGAGGAAGAGCAGG + Intergenic
1200818991 Y:7562876-7562898 GGTGGTATTGGGGGAAGAGGTGG - Intergenic
1202095904 Y:21247947-21247969 GGGTGTATTGGAGCATAAGAAGG + Intergenic