ID: 1138244837

View in Genome Browser
Species Human (GRCh38)
Location 16:55459850-55459872
Sequence ACTGCAGGAGGGAAGCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 709
Summary {0: 1, 1: 0, 2: 2, 3: 69, 4: 637}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138244837 Original CRISPR ACTGCAGGAGGGAAGCTGGG TGG (reversed) Intronic
900100612 1:960613-960635 ACTGCCGGAGGGCTGCTCGGCGG - Exonic
900174702 1:1286551-1286573 CCAGAAGGAGGGAAGGTGGGAGG + Intronic
900345820 1:2209826-2209848 AAGGCAGGAGGGAGGCTGGAAGG - Intronic
900379283 1:2375834-2375856 ACTGCAGGAATGCAGCCGGGTGG - Intronic
900384438 1:2403364-2403386 GCTGCAGGCGGGAAGCCAGGCGG + Exonic
900940223 1:5793633-5793655 ATGGCAGGAGGGAAGCAGGCTGG + Intergenic
901061052 1:6472035-6472057 CCTCCTGGAGGGAAGCTCGGGGG + Intronic
901752032 1:11416260-11416282 CCTGGAAGAGGGAACCTGGGTGG - Intergenic
901965652 1:12863758-12863780 AGTGTAGGAGGGAGGCTGAGGGG + Intronic
901981049 1:13034136-13034158 AGTGTAGGAGGGAGGCTGAGGGG + Intronic
902001038 1:13194794-13194816 AGTGTAGGAGGGAGGCTGAGGGG - Intergenic
902020268 1:13340498-13340520 AGTGTAGGAGGGAGGCTGAGGGG - Intergenic
902576936 1:17384051-17384073 AAGGCAGGAGTGAACCTGGGAGG + Intronic
902623783 1:17665127-17665149 ACTGCAGGTGTGAAGGTGAGCGG - Intronic
903027391 1:20439065-20439087 ATTGCAGGAATGAAGGTGGGAGG + Intergenic
903340782 1:22653100-22653122 ACTGCCTGAGGGCAGCAGGGTGG + Intronic
903738840 1:25546421-25546443 ACTGCAGGCATGAAGCTGGGTGG - Intronic
903768737 1:25750857-25750879 CCTGCAGGAAGGAAGAGGGGAGG + Intronic
904370046 1:30042577-30042599 ACCATAGGAGGGAAGCTGAGGGG + Intergenic
904389332 1:30171514-30171536 ACTGGAGGGGGGAGGGTGGGTGG - Intergenic
905646234 1:39626662-39626684 ACTGCAGGAGGGGAGCGATGTGG + Exonic
906659318 1:47571384-47571406 ACTCCAGCATGGAGGCTGGGAGG - Intergenic
907141355 1:52188321-52188343 ACTGGAGGGTGGAGGCTGGGAGG + Intronic
907250269 1:53133471-53133493 TCAGCAGCAGGGAGGCTGGGAGG + Intronic
907386513 1:54129120-54129142 AAAACAGCAGGGAAGCTGGGAGG + Intergenic
907922529 1:58927063-58927085 ACTGCAGGAGAGATGGCGGGTGG + Intergenic
909431056 1:75588245-75588267 AGTGAAGGAGGGAAGGAGGGGGG + Intronic
910701017 1:90074203-90074225 CATGCAGGAGGGAACCTGAGGGG - Intergenic
911060353 1:93742132-93742154 ACTGGAGAAGGGAAGGTGAGTGG + Intronic
911670921 1:100606622-100606644 CCCGCAGGAGGGAAGCTAGGTGG + Intergenic
911802173 1:102155874-102155896 ACTGCAGGAAGTAAGCTGGTTGG - Intergenic
913599684 1:120411124-120411146 TCTACAGGATGGAAGCTGAGAGG - Intergenic
913667390 1:121060793-121060815 CCTGAAGGAGAGAAGCTGTGGGG - Intergenic
914019081 1:143847936-143847958 CCTGAAGGAGAGAAGCTGTGGGG - Intergenic
914087694 1:144468492-144468514 TCTACAGGATGGAAGCTGAGAGG + Intergenic
914310917 1:146465713-146465735 TCTACAGGATGGAAGCTGAGAGG - Intergenic
914591187 1:149107433-149107455 TCTACAGGATGGAAGCTGAGAGG + Intergenic
914657632 1:149756143-149756165 CCTGAAGGAGAGAAGCTGTGGGG - Intergenic
914918146 1:151830835-151830857 ACGTCAGGGAGGAAGCTGGGTGG - Intronic
915204197 1:154257354-154257376 ACCCCAGGAGGGAGGTTGGGAGG - Exonic
915239214 1:154507886-154507908 AATGCAGGAGGGAGGCTGAAGGG - Intronic
915267542 1:154729638-154729660 AATGGAGGAGGGAAGCCTGGAGG + Intronic
915270122 1:154747874-154747896 CCAGCATGAGGGAAGCTCGGAGG - Intronic
915378231 1:155416881-155416903 AAGGAAGGAGGGAAGGTGGGTGG - Intronic
915604583 1:156942525-156942547 ACAGAAGTAGAGAAGCTGGGAGG - Intronic
915640332 1:157219567-157219589 TCTGGAGTAGGGAAGATGGGAGG + Intergenic
915909019 1:159900602-159900624 ACAGCAGGAGAGAATCTGGTCGG + Intergenic
916168235 1:161982147-161982169 ACCGCAGGCCTGAAGCTGGGTGG - Intergenic
916407402 1:164510986-164511008 ACTGCAGAGGGGAAGGTGAGAGG - Intergenic
916890474 1:169107823-169107845 ACTGCGTGAGGGAAGGAGGGAGG + Intronic
917441414 1:175072259-175072281 ACTGCAGAAGGGGTGTTGGGTGG - Intronic
917612605 1:176703842-176703864 AGTGAAGGAGGGAAGGTGGCAGG - Intronic
919256235 1:195128527-195128549 ACTCCAGGAGGGACTCTGTGTGG + Intergenic
919923017 1:202177495-202177517 ACAGAAGGAGGGAAGGAGGGAGG - Intergenic
919938048 1:202268026-202268048 TCTCCAGGAGAGAGGCTGGGAGG + Intronic
919990672 1:202707151-202707173 AATGCAGAAGGGATGCTGAGTGG + Intronic
920504034 1:206504117-206504139 ACTTGGGGAGGGAGGCTGGGCGG + Intergenic
920595898 1:207269618-207269640 ACTTCAGGGTGGAAGTTGGGAGG - Intergenic
922179623 1:223223688-223223710 AGTGCAGGAGGGAGTATGGGTGG - Intronic
922343238 1:224674462-224674484 ACACCAGCAGGGAAGCAGGGTGG - Intronic
922391462 1:225147782-225147804 ACTGGAGGGTGGAAGGTGGGAGG - Intronic
922404576 1:225298704-225298726 ACAGCAGGAGTGAGGGTGGGTGG + Intronic
922880960 1:228980304-228980326 ACTGGAGCAGGGAGGCTGGGAGG + Intergenic
923872246 1:238008421-238008443 ACTGGAGAAGGGGAGCTGTGAGG + Intergenic
1063567151 10:7180723-7180745 AGTGCGGGAGGGACGCAGGGGGG + Intronic
1064325189 10:14343801-14343823 CCTGGAGGAGGTAAGCGGGGAGG - Intronic
1064425647 10:15226876-15226898 GCTCCAGGTGGGAAGCTGGGGGG - Intronic
1064598920 10:16973636-16973658 ACTTGAGGTTGGAAGCTGGGAGG - Intronic
1064833519 10:19498921-19498943 ATTGGAGGAGGGTAGGTGGGTGG + Intronic
1065856977 10:29838898-29838920 AGTGCAGGAGGGAGGAGGGGAGG + Intergenic
1067508419 10:46875885-46875907 CCTGGAGGAGGAAAGATGGGTGG + Intergenic
1067653830 10:48175964-48175986 CCTGGAGGAGGAAAGATGGGTGG - Intronic
1067684063 10:48456824-48456846 ACTGCAGTGGGGAAGGAGGGAGG - Intronic
1067732456 10:48821795-48821817 AATGCAGGAGAGTAGCAGGGTGG + Intronic
1068343387 10:55738334-55738356 ATGGCAGGCGGGAACCTGGGAGG + Intergenic
1069059179 10:63875936-63875958 ACTTGAGGGGGGAAGGTGGGAGG - Intergenic
1069187511 10:65443714-65443736 ACTGCAGAGTGGAGGCTGGGAGG + Intergenic
1069678435 10:70266363-70266385 ACTGCTGTTGGGAGGCTGGGAGG + Exonic
1069897117 10:71686793-71686815 CCTCCAAGAGGGAAGCAGGGAGG + Intronic
1070439527 10:76429789-76429811 CCTACAGCAGGGAAGCTGGGTGG - Intronic
1070679407 10:78438194-78438216 AATGCAGGAGTGAGGCTGTGTGG + Intergenic
1070911724 10:80124905-80124927 ACTTCAGGAGGTGAGGTGGGCGG - Intergenic
1071127702 10:82354282-82354304 ACTACAGGAGCCAAGGTGGGAGG - Intronic
1071246848 10:83774090-83774112 AAGGCAGGAGAGAAGCTGGCTGG - Intergenic
1072068710 10:91895703-91895725 ACTTTAGGAGGCAAGATGGGTGG - Intergenic
1072841594 10:98780554-98780576 ACTACAGCAGGGAAGATGGCCGG + Intronic
1073260334 10:102184943-102184965 ACTGGAGGGTGGAAGATGGGAGG + Intergenic
1074419190 10:113294045-113294067 ACTGAAGGAGGGGACCTAGGCGG + Intergenic
1075256089 10:120926880-120926902 TCTGCAGGAGGGACCCTGGCTGG - Intergenic
1075345545 10:121679498-121679520 TCTGCAGGATGGAAGGTGGGTGG + Intergenic
1075688399 10:124379430-124379452 ACTGCAGGAGTGCAGATGAGTGG + Intergenic
1076277272 10:129212289-129212311 ACTGGTGGAGGGAAGGTGGCTGG - Intergenic
1076329500 10:129654157-129654179 GATGCAGGTGGGAAGCTGGATGG + Intronic
1076857739 10:133125865-133125887 TCTGCAGGAGGAAAGGTGGGAGG - Intronic
1077102516 11:828463-828485 GCAGCAGGTGGGAAGGTGGGCGG - Intronic
1077385752 11:2268881-2268903 ACTGCAGTCGAGAAGCTGTGGGG + Exonic
1077418414 11:2436626-2436648 ACTGGGGGTGGGAAGCTTGGCGG + Intergenic
1078380632 11:10836902-10836924 ACTTGAGGATGGAAGGTGGGAGG - Intronic
1081237126 11:40659282-40659304 AGGGCAGGAAGGAGGCTGGGTGG + Intronic
1082276496 11:50227597-50227619 AATGGAGGTGGGAGGCTGGGAGG + Intergenic
1083577283 11:63801222-63801244 AATGAAGGAGGGAAGGAGGGAGG + Intergenic
1083804884 11:65067642-65067664 ACTGCATGAGGTGATCTGGGCGG - Intronic
1083829122 11:65219843-65219865 ACACCAGGACGGAAGCAGGGAGG + Intergenic
1084424343 11:69076582-69076604 ACGGCAGGAGGGCAGGTGGAGGG - Intronic
1084424352 11:69076607-69076629 ACCGCAGGAGGGCAGGTGGAGGG - Intronic
1084424359 11:69076632-69076654 ACGGCAGGAGGGCAGGTGGAGGG - Intronic
1084424367 11:69076657-69076679 ACGGCAGGAGGGCAGGTGGAGGG - Intronic
1084424375 11:69076682-69076704 ACGGCAGGAGGGCAGGTGGAGGG - Intronic
1084424383 11:69076707-69076729 ACAGCAGGAGGGCAGGTGGAGGG - Intronic
1084424390 11:69076732-69076754 ACAGCAGGAGGGCAGGTGGAGGG - Intronic
1084424397 11:69076757-69076779 ACGGCAGGAGGGCAGGTGGAGGG - Intronic
1084424450 11:69076931-69076953 ACAGCAGGAGGGCAGGTGGAGGG - Intronic
1084424511 11:69077130-69077152 ACGGCAGGAGGGCAGGTGGAGGG - Intronic
1084424519 11:69077155-69077177 ACGGCAGGAGGGCAGGTGGAGGG - Intronic
1084424568 11:69077313-69077335 ACAGCAGGAGGGCAGGTGGAGGG - Intronic
1084440653 11:69170939-69170961 TCTGGAGGTGGGAAGCTGGCTGG - Intergenic
1084737265 11:71113616-71113638 CCTGCAGGTGAGAAGCTGGGAGG + Intronic
1085379625 11:76102835-76102857 TCTGCAGGTCAGAAGCTGGGTGG + Intronic
1086956268 11:92937257-92937279 AAGGGAGGAGGGAAGCTTGGAGG + Intergenic
1087280113 11:96200582-96200604 AATGCAGGAGGGTTGCTGTGAGG - Intronic
1088397773 11:109387677-109387699 ACTAAAGGAGGGAAGGAGGGAGG - Intergenic
1088583087 11:111334245-111334267 CATCCAGGAGGAAAGCTGGGTGG + Intergenic
1088593415 11:111422398-111422420 CCAGCAGGAGGGCACCTGGGTGG - Intronic
1088652281 11:111968509-111968531 ACAGCAGGAGAAAAGCTGAGTGG + Exonic
1089129475 11:116200622-116200644 AGTGCCGGTGGGCAGCTGGGTGG - Intergenic
1089300784 11:117497621-117497643 GCTGCTGGAGGGAAGGAGGGAGG - Intronic
1089597450 11:119589871-119589893 TCTGCAGGAGGGAAGGAGGGTGG + Intergenic
1089685271 11:120142638-120142660 CCTGCAAAAGGGAAGCTGTGAGG + Intronic
1090076063 11:123580703-123580725 ACTACAGAGCGGAAGCTGGGCGG - Intronic
1091157252 11:133385069-133385091 AATGCAGAAGGGAGGGTGGGGGG + Intronic
1091191533 11:133699620-133699642 CCTGCAGCAGAGAATCTGGGAGG + Intergenic
1091212208 11:133871746-133871768 ACAGCAGGAGGTGAGCAGGGTGG + Intergenic
1091412347 12:252332-252354 ATGGCAGGAGTGAAGTTGGGAGG + Intronic
1091845822 12:3655724-3655746 CCTCCAGGAGGCAGGCTGGGTGG - Intronic
1091912415 12:4243065-4243087 AATGCATGAGGGACTCTGGGTGG - Intergenic
1092015587 12:5155933-5155955 AATGCAGCAGGGAAGCTTTGTGG + Intergenic
1092238239 12:6822716-6822738 ACTGGAGGAGGGAGGGAGGGAGG - Intronic
1092401506 12:8182563-8182585 ACTGCAGGAGGGAAGAAAGATGG + Intronic
1092719312 12:11425168-11425190 GCAGCAGGGTGGAAGCTGGGTGG - Intronic
1093820082 12:23604475-23604497 TCTCCAGGAGGGAAGCTGCCAGG - Exonic
1094039641 12:26109568-26109590 ACGGGAGGAGGAAAGCAGGGAGG + Intergenic
1094426596 12:30322751-30322773 CCTGCAGGATGGCAGCTGGTGGG - Intergenic
1094573737 12:31664856-31664878 ACTTTAGGAGGCAAGGTGGGTGG - Intronic
1094751813 12:33418267-33418289 AAAGTAGGAGGGAAGCTGGGAGG - Intronic
1096750997 12:53758818-53758840 ACTGAGGGAGGGAAGCGGGGAGG - Intergenic
1096840783 12:54378403-54378425 ACTGTTGGAGGGCAGGTGGGAGG - Intronic
1096943192 12:55372473-55372495 AGGGAAGGAGGGAAGCAGGGAGG + Intergenic
1097129997 12:56804832-56804854 AGCACAGGAGGGAAGCTGAGGGG - Intergenic
1097763589 12:63497356-63497378 ACTACAGGATGGAGGATGGGAGG + Intergenic
1097810582 12:64014459-64014481 ACTGGAGGATGGAGGCTGGGAGG + Intronic
1097889047 12:64759208-64759230 GCTGCAGGAGGGCAGGTGGCGGG + Exonic
1098753128 12:74321612-74321634 AGTGGAGGATGGAAGATGGGAGG + Intergenic
1099177087 12:79434820-79434842 AAGGCAGGATGGAAGGTGGGCGG - Intronic
1099280317 12:80636491-80636513 AGTGCAGGAAGGAGGCTAGGAGG - Intronic
1099391061 12:82078760-82078782 AGTCCAGGAGGGAAGCATGGAGG - Intergenic
1102448512 12:113022868-113022890 AGTGAAGAAGGGAAGCTTGGAGG - Intergenic
1102508179 12:113397259-113397281 GCTGCAGGAGGTGGGCTGGGGGG - Exonic
1103772105 12:123335359-123335381 AATCCAGGAGGGATCCTGGGAGG + Intronic
1103975475 12:124699967-124699989 ACTGCAGGCGTGGAGCGGGGAGG - Intergenic
1104755790 12:131268694-131268716 ACTGCAGTTGGGAGGCTGGTGGG - Intergenic
1104914260 12:132256653-132256675 ACTGGAGGGGGGACGCTGGAGGG + Intronic
1106083343 13:26518670-26518692 ACTGGAGGAGAGAAGAAGGGAGG + Intergenic
1106686375 13:32064407-32064429 GCTGCAGGAGAGATGCAGGGGGG - Intronic
1106714496 13:32373847-32373869 AGTACAGGAGGGAAACCGGGAGG - Intronic
1107935845 13:45344798-45344820 ACTGCAGGAGGGCTGCATGGCGG + Intergenic
1110321082 13:74160739-74160761 ACTGCATGAGGTTAGCAGGGAGG + Intergenic
1112244651 13:97720724-97720746 ACTGAAGGAGGGAAGAAGGAAGG - Intergenic
1112262018 13:97885680-97885702 AGTGCAGTGGGGAAACTGGGAGG + Intergenic
1113045542 13:106151042-106151064 ACTGCAGGACTGAAGCAGGGTGG - Intergenic
1114654824 14:24309882-24309904 ACTGCAGAAGGTGGGCTGGGAGG + Intronic
1114863767 14:26561172-26561194 ACAGCAGGAGGTGAGCTGTGGGG - Intronic
1114969900 14:28013152-28013174 TCAGAAGGAGGAAAGCTGGGAGG - Intergenic
1115630165 14:35236986-35237008 AGTGAAGGAGGGAAGGAGGGAGG - Intronic
1115871139 14:37803830-37803852 ACAGAAGGAGGGATGTTGGGTGG + Intronic
1116504254 14:45659431-45659453 ACTTGAGGATGGAAGGTGGGAGG - Intergenic
1117311789 14:54533031-54533053 AATGCAATGGGGAAGCTGGGAGG - Intronic
1117799140 14:59425711-59425733 ACTGCTGGAGGGAAGCAGTGAGG + Intergenic
1118025202 14:61761683-61761705 CCTGGAGGAAGGAAGCTAGGTGG + Intergenic
1118487540 14:66228048-66228070 GCTGCATGAGGGAAGCTGAGAGG + Intergenic
1118634780 14:67737610-67737632 ACCATAGGAGGGAATCTGGGTGG + Intronic
1118895598 14:69943021-69943043 AGTGGAGGAGGGAAGTCGGGTGG + Intronic
1119203722 14:72778246-72778268 ACAGCAGGAGGTGAGCTGTGGGG + Intronic
1119539242 14:75428036-75428058 CCTGCGGGAGGGACGCTCGGCGG + Intronic
1119989370 14:79178132-79178154 ACTGCATCAGGAAACCTGGGTGG - Intronic
1120649197 14:87111024-87111046 AATGAAGGAGGGAAGCAAGGAGG - Intergenic
1121211390 14:92210355-92210377 CCTGCAGGGAGAAAGCTGGGGGG + Intergenic
1121564247 14:94896704-94896726 ACTGCAGGAGAGTGGCAGGGTGG - Intergenic
1121730281 14:96182028-96182050 AAGGAAGGAGGGAAGCTGGGGGG - Intergenic
1122097265 14:99381113-99381135 ACTGCAGCAGGCCAGCTTGGTGG + Intergenic
1122665797 14:103328651-103328673 AATGCAGGATGGCTGCTGGGTGG + Intergenic
1122671767 14:103378277-103378299 ACTGGAGGAGGAAACCGGGGAGG + Intergenic
1122873484 14:104652006-104652028 CCTGCAGGAGGGGAGCAGGGGGG - Intergenic
1122903158 14:104790261-104790283 CCTGCAGGAGCAAGGCTGGGGGG + Intronic
1122919439 14:104874012-104874034 AGTGCAGCCTGGAAGCTGGGAGG - Intronic
1123043603 14:105500538-105500560 CCTGCGGGAGGGAAGCCGGCAGG + Intergenic
1123755488 15:23394671-23394693 CCTGCAGGAGGAAGGGTGGGGGG + Intergenic
1124208583 15:27743845-27743867 GCTGCGGGAGGGAAGCTGGCTGG - Intergenic
1124228829 15:27922959-27922981 ACTGGAGGATGAAAGGTGGGAGG - Intronic
1124664804 15:31583174-31583196 ACTGCAGGAGAGAAGCTTGCAGG + Intronic
1125481710 15:40085578-40085600 ACTGCAGGAGCTCAGCTGAGAGG - Intergenic
1125843159 15:42824711-42824733 ACTTCAGGATGGAGGGTGGGAGG + Intronic
1126181918 15:45793736-45793758 ACAGAAGGAGGGAAGGAGGGAGG - Intergenic
1126223118 15:46238137-46238159 ACTGGAGGTTGGAAGGTGGGAGG + Intergenic
1126775157 15:52094159-52094181 AGGTCAGGAGGGAGGCTGGGAGG + Intergenic
1128752482 15:70159316-70159338 TCTGCAGGTGGGGGGCTGGGGGG - Intergenic
1128756216 15:70185667-70185689 ACTGAAGGAAGGAAGCAGGGAGG + Intergenic
1128801968 15:70502655-70502677 ACTGCAGGAGGGGACCCAGGGGG - Intergenic
1129188560 15:73924832-73924854 ACTGCAGGGGGCAAGCAGGAGGG + Intergenic
1129275493 15:74442711-74442733 GCTGCTGCAGGGGAGCTGGGTGG - Intergenic
1129393259 15:75231139-75231161 AGGGCAGGAGGGAAGGTGGGGGG - Intergenic
1129699479 15:77759342-77759364 AAGGCTGGAGGGCAGCTGGGAGG + Intronic
1129879850 15:78999315-78999337 CCTGCAGGATGGAAGTTTGGGGG + Intronic
1129898073 15:79123141-79123163 TCTGTAGGAGGGAGGCTGTGAGG + Intergenic
1130123412 15:81071717-81071739 ACTTGAGGATGGAAGGTGGGAGG - Intronic
1131177268 15:90217857-90217879 GCTGCAGGAGGGATGGAGGGTGG + Intronic
1131350232 15:91692879-91692901 ACTCCAGGGGGGAAGCAGGTTGG - Intergenic
1131352782 15:91717034-91717056 ACTGCTGCAGGGAAACTGGTTGG + Intergenic
1131403874 15:92147580-92147602 ACTGCAGGAGGCAGGCAGGATGG - Intronic
1132084519 15:98896407-98896429 GCTGCAGAAAGGAAGCTTGGGGG - Intronic
1132173118 15:99683857-99683879 ACTCAAGGAGGAAGGCTGGGAGG - Intronic
1132602339 16:778896-778918 ACTGAAGGAGGGAGAGTGGGAGG + Intronic
1132688392 16:1171710-1171732 ACTCCAGGAGGGAGGGAGGGTGG - Intronic
1132871062 16:2115976-2115998 ACAGCAGGTGGGACTCTGGGTGG - Exonic
1133023824 16:2979089-2979111 ACTTCGGGAGGCAAGGTGGGTGG + Intronic
1133119239 16:3596137-3596159 ACTGCAGGTGAGATGCTGGGTGG - Exonic
1133175574 16:4011458-4011480 ACAGCGGGTGGGAAGTTGGGAGG + Intronic
1133220259 16:4316552-4316574 ACTTCAGCTGGGAAGTTGGGCGG + Intronic
1133256177 16:4517830-4517852 CCTGCAGGAGGGCACCTGGCAGG - Intronic
1133399410 16:5473791-5473813 ATTGAAAGAGGGAAGGTGGGTGG + Intergenic
1133751495 16:8729573-8729595 ACTTCAGGAGCCAAGATGGGAGG + Intronic
1134610620 16:15605417-15605439 AAGGCAGGAGGGAGGCTGGCAGG + Intronic
1135695557 16:24583107-24583129 ACTGCGGAAGGGTACCTGGGAGG + Intergenic
1135912963 16:26578153-26578175 ACTGATGGATGGAAACTGGGAGG - Intergenic
1136141463 16:28291812-28291834 AGTCCAGGAGTGCAGCTGGGAGG - Intergenic
1136292513 16:29284407-29284429 AATGTAGGGGGTAAGCTGGGGGG - Intergenic
1136399012 16:30007753-30007775 ACTGCAGGAGGACAGGTGGCTGG - Intronic
1136460871 16:30409316-30409338 ACTGCAGCAGTGAGGGTGGGTGG + Intronic
1137598767 16:49742343-49742365 AGGGGAGGAGGGAAGCAGGGGGG + Intronic
1138244837 16:55459850-55459872 ACTGCAGGAGGGAAGCTGGGTGG - Intronic
1138340265 16:56284620-56284642 GCTGCTGGGGGGCAGCTGGGAGG - Intronic
1138600207 16:58049554-58049576 AAGGCAGGCAGGAAGCTGGGAGG - Intergenic
1139365808 16:66432839-66432861 ACTGGAGGAAGCAAGCTAGGTGG - Intronic
1139527128 16:67523919-67523941 ACTTCGGGAGGCAAGGTGGGAGG - Intronic
1139543817 16:67639207-67639229 CCTGCTTGAGGGAGGCTGGGGGG + Intergenic
1139582184 16:67880259-67880281 GCAGCAGCAGGGAAGGTGGGTGG + Intronic
1139922513 16:70468972-70468994 ACTGGGGGAGGGCAGCTAGGTGG + Intronic
1140289692 16:73641590-73641612 ACTGATGTAGGGAAGATGGGAGG + Intergenic
1140419666 16:74807828-74807850 GCTGCAGGAGGGAGGCTGGCTGG - Intergenic
1140468129 16:75198299-75198321 AGTCCTGGAGGGAATCTGGGTGG + Intergenic
1140933824 16:79652590-79652612 AGTGCAGGACTGAAGCTGGTGGG + Intergenic
1141606590 16:85157476-85157498 AATGCATGAGGAGAGCTGGGAGG - Intergenic
1141635763 16:85313096-85313118 ACAGCAGGAGGGAAGCCTGTGGG + Intergenic
1141910211 16:87053512-87053534 ACTGCTGGCGGCAAGCTTGGAGG + Intergenic
1142000164 16:87659878-87659900 GCTGGGGGAGGGAACCTGGGAGG - Intronic
1142029118 16:87829691-87829713 GCTGCAGGGGTGAAGTTGGGAGG - Intergenic
1142098403 16:88258422-88258444 AATGTAGGGGGTAAGCTGGGGGG - Intergenic
1142292774 16:89200521-89200543 ACAGGAGGAGGGCAGGTGGGAGG + Intronic
1142941326 17:3382086-3382108 CCTGGAGGAGTGGAGCTGGGCGG + Intergenic
1143070992 17:4293138-4293160 ACTGCTGGAGGGGAGGTGGGGGG - Intronic
1143097917 17:4488298-4488320 CCTGAAGTGGGGAAGCTGGGGGG + Intergenic
1143473330 17:7190006-7190028 AATGCGGGAGGGAGGGTGGGGGG - Exonic
1143682431 17:8487347-8487369 AGTCCAGCAGTGAAGCTGGGGGG - Intronic
1143737358 17:8922138-8922160 AGGGAAGGAGGGAAGGTGGGAGG + Intronic
1143869777 17:9949834-9949856 AGGGCAGGAGGGAAGGAGGGAGG - Intronic
1144645665 17:16971975-16971997 AGGGCAGGAGGGCAGGTGGGAGG - Intronic
1144872063 17:18377816-18377838 AGGGCAGGAGGGCAGGTGGGAGG - Exonic
1145224583 17:21117200-21117222 GCTGGAGGAGGGACGCTGGTAGG + Intergenic
1145989991 17:29073593-29073615 ATTGCAGGAGAGAAGGGGGGCGG + Exonic
1146126901 17:30237421-30237443 GTTGCAGGGGGGATGCTGGGAGG + Intergenic
1146471496 17:33128520-33128542 CATGCAGGAGGGAAGTTGGCAGG + Intronic
1146647418 17:34584374-34584396 ACTGCTGGTGAGAAGCTAGGGGG - Intronic
1146776785 17:35626140-35626162 ACAGCAGGAGGCAGGCTGGTAGG - Intronic
1148678846 17:49461315-49461337 ACTGGAGGAGCCAAGATGGGAGG + Intronic
1148775954 17:50095837-50095859 ACTGCAGGAAGGGAGTAGGGTGG + Intronic
1151535741 17:74737872-74737894 ACTGCAGGGAGGAAGGTGGGAGG - Intronic
1151560399 17:74866652-74866674 TCCCCAGGAGGGAAGCTGGGTGG + Intronic
1151691798 17:75691091-75691113 TCTGCTGCTGGGAAGCTGGGTGG + Intronic
1151749224 17:76027246-76027268 ACGGCAGGAGGGCAGGTGGGAGG + Exonic
1152012601 17:77727471-77727493 AAGGCCGGAGGGAAGCTGAGGGG + Intergenic
1152146218 17:78570358-78570380 AATGAAGGTGGGGAGCTGGGGGG + Exonic
1152275060 17:79351487-79351509 ACAGCAAGATTGAAGCTGGGAGG - Intronic
1152437150 17:80283435-80283457 ACTGCAGGAGAGACCCTTGGAGG - Intronic
1152554538 17:81046356-81046378 ACTCCAGGAGCACAGCTGGGAGG - Intronic
1153643236 18:7173318-7173340 ACTGCAGGCGGGCAGCGGTGAGG + Intergenic
1153679679 18:7488720-7488742 ACGGCAGGTGGGAAGGTGGGAGG - Intergenic
1153973950 18:10250290-10250312 ACTTGAGGATGGAGGCTGGGTGG - Intergenic
1156369760 18:36462260-36462282 ACTGAAGGAAGGTAGCTGGAGGG - Intronic
1156726878 18:40139466-40139488 AGTGAAGGATGGAAGCTGGATGG - Intergenic
1156844527 18:41649216-41649238 ACTGCAGGTGAGGGGCTGGGTGG - Intergenic
1157003422 18:43553757-43553779 ACTTGAGGGTGGAAGCTGGGAGG - Intergenic
1157353862 18:46916127-46916149 ACAGCAGGAGGGAATATGGCAGG + Intronic
1157694169 18:49707795-49707817 ACTGCAGGGCAGAAGCTGGCTGG - Intergenic
1158004277 18:52654257-52654279 ACTACAGGTGGGAGGGTGGGGGG + Intronic
1158448499 18:57542250-57542272 ACTGCAGGAAGGGAGCAAGGTGG + Intergenic
1158700666 18:59742999-59743021 ACTCCAGAAGGGAAGCAGTGGGG - Intergenic
1158829334 18:61260374-61260396 ACTGCAGGTGGAGAGCTGAGAGG - Intergenic
1159921843 18:74233558-74233580 ACAGCAGAAGTGCAGCTGGGTGG - Intergenic
1159924655 18:74257220-74257242 GCAGCAGGAGGGCAGGTGGGAGG - Intronic
1160029945 18:75249682-75249704 ACTGCAGGAGTGAGGCAGGGAGG - Intronic
1160029971 18:75249776-75249798 ACTGCAGGTGTGAGGCAGGGAGG - Intronic
1160029997 18:75249865-75249887 ACTGCAGGGGTGAGGCAGGGAGG - Intronic
1160050409 18:75428174-75428196 ACAGCAGGAGGAAAGCTGAATGG + Intergenic
1160173870 18:76577527-76577549 ACTTTGGGAGGCAAGCTGGGCGG - Intergenic
1160263270 18:77315603-77315625 ACTGCAGGGTGCAGGCTGGGAGG - Intergenic
1160520690 18:79506360-79506382 ACCGGAGGTGGGAAGATGGGGGG - Intronic
1160580870 18:79884097-79884119 ATTGCAGGCGGGAGGCTGGTGGG - Intronic
1160675956 19:391510-391532 TCTGTAGGAGGTAAGGTGGGGGG - Intergenic
1160785076 19:896583-896605 GCTGCAGGAGCCAGGCTGGGGGG - Exonic
1160865849 19:1255639-1255661 CCTGCAGCAGGGAGGCTGAGGGG - Exonic
1161053653 19:2179057-2179079 AGTGCATAAGGAAAGCTGGGGGG + Intronic
1161271142 19:3390042-3390064 ACCCCAGGAGGGAAGGAGGGAGG + Intronic
1161575283 19:5051473-5051495 ACTGCAGCAGGGAAGCCAGATGG + Intronic
1162028709 19:7908326-7908348 CCTCCAGGAGGGGAGCTAGGGGG + Intronic
1162099534 19:8331543-8331565 CCTGCAGGAGGGTACCTGGAGGG + Intronic
1162450263 19:10750058-10750080 TCTGCAAGAGAGAAGCTTGGAGG + Intronic
1162782028 19:13011493-13011515 ACTTCAGGAGTGAGGGTGGGTGG + Intronic
1162851875 19:13437365-13437387 ACTGCAGAAGGGAAGAGAGGTGG + Intronic
1162907276 19:13831365-13831387 GCTCCAGGAGGGAGGCTGGGAGG + Exonic
1163087702 19:14994292-14994314 TCTGCAGGGGGGATGCAGGGAGG - Intronic
1163173441 19:15548708-15548730 CCTGGAGGAGGGAATGTGGGAGG + Intronic
1163267996 19:16233167-16233189 AGTGCATTAGGGGAGCTGGGCGG + Intronic
1163544519 19:17933140-17933162 GCTGGAGGAGGGGTGCTGGGAGG + Intronic
1164445558 19:28314732-28314754 ACTGCAGGGGAGATGCTGTGGGG - Intergenic
1164553585 19:29232772-29232794 ACTGCAGGAAGTAAGCAAGGAGG + Intergenic
1164553696 19:29233648-29233670 CCTTCAGGTGGGCAGCTGGGGGG - Intergenic
1164905966 19:31968296-31968318 TCTGTAGGAAGGAGGCTGGGAGG - Intergenic
1165084012 19:33330054-33330076 AATGAAGGTGTGAAGCTGGGTGG - Intergenic
1165106851 19:33475358-33475380 ACTGAAGGAAGGATGCTGTGTGG - Intronic
1165169584 19:33882256-33882278 TCTACAGGAAGGGAGCTGGGAGG - Intergenic
1165231391 19:34389391-34389413 ACCGCAGGGTGGAAGCTGAGAGG - Intronic
1165994404 19:39833809-39833831 GTTGCAGGAGGGAGGCTGGGAGG - Intronic
1166015159 19:39974149-39974171 ACAGCAGGAGGGAAGGCTGGAGG + Intronic
1166043632 19:40217355-40217377 ACTGCAGCAGGCAAGCTGCGAGG + Exonic
1166220901 19:41363855-41363877 GCTGGGGGAGGGAAGCGGGGTGG - Intronic
1166816711 19:45550688-45550710 AAATCAGGAGGGAAACTGGGAGG - Intronic
1166994646 19:46714365-46714387 GATCCAGGAAGGAAGCTGGGGGG - Intronic
1167108570 19:47445765-47445787 GCAGCAGGAGGGAAGCAGGTTGG + Intronic
1167377485 19:49119666-49119688 GCTGCAGGAGGGACGTGGGGTGG - Exonic
1167620364 19:50556883-50556905 CGTCCAGGAGGGAAGCCGGGAGG + Intronic
1167857135 19:52251235-52251257 ACTTGAGGATGGAGGCTGGGAGG - Intergenic
1168240506 19:55086692-55086714 TCTGCAGGCGGGAAACCGGGAGG - Exonic
926514590 2:13825922-13825944 ACTGGAGGGTGGAAGGTGGGAGG + Intergenic
926659730 2:15451280-15451302 ATGGCAGGAGGATAGCTGGGGGG - Intronic
927517777 2:23682115-23682137 AGTGCAGGAAGGAAGTGGGGAGG - Intronic
927699422 2:25258475-25258497 CCTGCAGTAGGTAGGCTGGGGGG + Intronic
929861678 2:45683613-45683635 ACTGCTGCATGGGAGCTGGGGGG + Intronic
929975101 2:46626091-46626113 ACTACTGGAGGGAAGAGGGGAGG - Intergenic
930236509 2:48893990-48894012 ACAGCAGGAGAGAAGATAGGAGG + Intergenic
930800521 2:55438328-55438350 AGTGCGGGAGGGAAGCCGAGGGG + Intergenic
931122117 2:59231497-59231519 ACTGCTCCAGGGAATCTGGGAGG - Intergenic
931321961 2:61180584-61180606 GCTGGAGGAGAGCAGCTGGGAGG - Intronic
931390857 2:61842777-61842799 ACTGCAGGAGCGCAGCTGGAGGG - Intronic
931808300 2:65829495-65829517 ACTGCAGGTAGGAAGGAGGGAGG - Intergenic
932398314 2:71463152-71463174 AGCTCAGGAGGGAAGCTGAGGGG - Intronic
932787937 2:74623913-74623935 ACTTCGGGAGGCAAGTTGGGAGG - Intronic
933042539 2:77487488-77487510 AACGCAGGAGAGAAGCTGAGAGG + Intronic
934603315 2:95675473-95675495 ACAGAATGATGGAAGCTGGGTGG + Intergenic
935339446 2:102046539-102046561 AATGCAGGAGGGATGCTGCCAGG + Intergenic
935683860 2:105666255-105666277 ACTGAAGGAAGAAACCTGGGAGG - Intergenic
935888520 2:107649771-107649793 ATTGGAGGATGGAAGCTGGGAGG + Intergenic
936536695 2:113317699-113317721 ACAGAATGATGGAAGCTGGGTGG + Intergenic
937222812 2:120351847-120351869 GCTGGAGGTGGGCAGCTGGGAGG + Intergenic
937725309 2:125157471-125157493 ATTGGAGGATGGAAGTTGGGAGG - Intergenic
937815229 2:126243847-126243869 ACTGCAGATGAGAAGATGGGAGG + Intergenic
939883130 2:147652366-147652388 ACTGCACTAGGGAAGATGGCAGG - Intergenic
940818463 2:158324159-158324181 ACTGTGGGAGGCAAGATGGGTGG - Intronic
941155401 2:161971741-161971763 AGTGCCAGAAGGAAGCTGGGTGG - Intronic
941476418 2:165956147-165956169 ACAGCAGGAGGTGAGCTGCGGGG - Intergenic
942772998 2:179545300-179545322 AGTGCAGGAGAGAAGAGGGGAGG + Intronic
943779172 2:191802749-191802771 ACAGCAAGAGGATAGCTGGGTGG + Intergenic
946305780 2:218856243-218856265 ACAGAAGGAGGGAAGTAGGGAGG + Intergenic
946896276 2:224327717-224327739 AAGGCAGGAGGGAATCTGAGAGG - Intergenic
947154171 2:227144878-227144900 ACTGCAGGAGAGAAGGAAGGAGG + Intronic
947198095 2:227589063-227589085 ACTTGAGGGTGGAAGCTGGGAGG - Intergenic
947605710 2:231483945-231483967 TCTGCACGACGGATGCTGGGAGG - Intergenic
947754610 2:232552452-232552474 ACTTTAGGAGGCAAGGTGGGTGG - Intronic
948118991 2:235514816-235514838 ACTGCATGAGGGAGGCGGGATGG + Intronic
948851628 2:240711163-240711185 AGAGCAGGCAGGAAGCTGGGGGG + Intergenic
949037618 2:241824444-241824466 TTTGCAGGAGGGAAGCTGGCTGG - Intergenic
1169391976 20:5198038-5198060 AGGGCAGGAGGAAAGCCGGGGGG - Intergenic
1170013575 20:11755506-11755528 ACTGCAGAAGGGAAGCAGTTAGG - Intergenic
1170362177 20:15558341-15558363 AGTGCAGGAGGGAAGGTGCTGGG - Intronic
1170880942 20:20296142-20296164 AATGAAGGAGGGAAGGAGGGAGG - Intronic
1170950742 20:20933705-20933727 TGAGCAGGAGGGAAGGTGGGAGG + Intergenic
1172240840 20:33411537-33411559 AGTGCAGGATGGAAGTGGGGAGG - Intronic
1172613410 20:36267690-36267712 CCTGTGGGAGGGGAGCTGGGTGG - Intronic
1172806817 20:37617957-37617979 TCTGCAGGAGGGGCTCTGGGTGG + Intergenic
1172832486 20:37847974-37847996 AGTGCAGGAGTGAATGTGGGGGG + Intronic
1173019318 20:39253882-39253904 ATTGCAGGTGGGGAGCTTGGGGG + Intergenic
1173226274 20:41164023-41164045 GCTGGGGGAGGGAAGATGGGAGG + Intronic
1173258823 20:41415182-41415204 ACTTCAGGCGGGAATCTTGGTGG - Exonic
1173620239 20:44430750-44430772 ACGGGAGGCTGGAAGCTGGGAGG + Exonic
1173957295 20:47043503-47043525 ACTGCAGAAAGGATGCTGAGAGG - Intronic
1175064383 20:56272666-56272688 AGCACAGGAGGGAAGCTAGGAGG + Intergenic
1175162676 20:57020736-57020758 CCTGCAGGGGAGGAGCTGGGAGG - Intergenic
1175223565 20:57431969-57431991 ACTGCAGCAGGGCAGCGGGTCGG + Intergenic
1175262601 20:57684195-57684217 ACTGCGGGAGGGGAGGCGGGTGG + Intronic
1175265681 20:57702066-57702088 ATTTCAGAAGGGAAGCTGAGAGG - Intronic
1175576947 20:60067368-60067390 CCAGGAGGAGGGATGCTGGGTGG + Intronic
1175803804 20:61816086-61816108 CCCGCAGAAGGGCAGCTGGGGGG + Intronic
1175940435 20:62535246-62535268 AATGCAGGAGGGAAGGAGGGAGG + Intergenic
1176015223 20:62927432-62927454 ACTGCAGGAAAGAGACTGGGAGG + Intronic
1176122048 20:63458380-63458402 AGGGCAGGAGGGGAGCAGGGTGG - Intronic
1176153023 20:63602771-63602793 ACTGTGGCAGGGAGGCTGGGAGG - Intronic
1179303576 21:40134888-40134910 ACTTCAGGATTGAAGCTGAGAGG - Intronic
1179403759 21:41108672-41108694 ATGGCTGGAGGGAAGCTGGGAGG + Intergenic
1179450688 21:41466549-41466571 AGGGCAGGAGGGAAGCTGGCAGG - Intronic
1180056226 21:45360432-45360454 ACTGCAGCAGGGACTGTGGGCGG + Intergenic
1180085615 21:45506794-45506816 AGTGCTAGAGGGAAGGTGGGAGG - Intronic
1180648540 22:17359777-17359799 AGAGCAGGACAGAAGCTGGGAGG + Intergenic
1180942177 22:19666539-19666561 CCTGCAGGCGCCAAGCTGGGGGG + Intergenic
1180963573 22:19773873-19773895 ACTGCAGGAGGGAAACTCGGCGG - Intronic
1181045972 22:20214418-20214440 CCTGCAGGCGGGAATCTGAGCGG - Intergenic
1181052975 22:20246424-20246446 ACTGCAGGAGGGAGTGTGGCGGG + Intronic
1181550439 22:23635895-23635917 ACTCCACGAGGGAAGTTGGTGGG - Intergenic
1181807584 22:25384376-25384398 GCTGCAGGAGCCAGGCTGGGAGG - Intronic
1182332576 22:29561455-29561477 ATTGCAGCAGGGAAATTGGGGGG + Intronic
1182468115 22:30530795-30530817 GCAGTAGGAGGGAAGCTGTGGGG - Intronic
1182710739 22:32321613-32321635 ACTGAAGGGCGGAAGGTGGGAGG - Intergenic
1182907429 22:33950258-33950280 TCTCCAGGGGAGAAGCTGGGTGG - Intergenic
1183348449 22:37320618-37320640 CCTGCAGGAGGAGAGCTGGCAGG - Intergenic
1183655019 22:39179611-39179633 CCTGTAGGAGGGGAGCTGGTGGG + Intergenic
1183830823 22:40417594-40417616 ACTCTAGGAGGGAAGATGGGAGG + Intronic
1184001194 22:41674886-41674908 ACCTCAGGGGGGAAGCTGGCAGG + Exonic
1184028586 22:41877327-41877349 ACTGCAGCAGGGAAGTCAGGGGG - Exonic
1184248646 22:43248242-43248264 ACAGTGGGAGGGAAGCTGGGGGG + Intronic
1184255226 22:43282630-43282652 ACTGATGGAGAGAAGGTGGGTGG - Intronic
1184350750 22:43942228-43942250 GCTCCAGGAGGGAAGATGGCAGG - Intronic
1184381367 22:44146892-44146914 CCTGGAGGATGGAAGTTGGGGGG + Intronic
1184513433 22:44946096-44946118 CCTGCGGGAGGGAAGCATGGGGG + Intronic
1184704882 22:46204014-46204036 ACTGGGGGAGGGAGGCAGGGAGG - Intronic
1185057368 22:48587987-48588009 ACTCCAGAAGGGAAGCAGGCAGG + Intronic
1185280778 22:49969002-49969024 CCTGCAGGAGGGCAGGTGGCAGG - Intergenic
1185401332 22:50619449-50619471 GCTGCAGGAGAAAAGCTGGAAGG - Intergenic
950390769 3:12694758-12694780 ACTGTAGGAGGCCAGATGGGTGG - Intergenic
950426852 3:12928875-12928897 ACTTCAAGGGGGAAGCTGTGCGG + Intronic
950604536 3:14066052-14066074 AATGCAAGAGAGAAGCTGGAAGG - Intronic
950643308 3:14362199-14362221 GCTGCAGGAGGGAAGGTGAGAGG - Intergenic
950899322 3:16482987-16483009 CCTGGAGGAGGGAAGGTGGATGG - Intronic
950938338 3:16866472-16866494 ACTGGAGGTGGGGAGGTGGGGGG - Intronic
951089627 3:18557050-18557072 ATTGCAGGTGGAATGCTGGGAGG + Intergenic
951629783 3:24707180-24707202 ACTGCAGAACTGAAGCTAGGAGG - Intergenic
952554541 3:34517402-34517424 ACTGCAGTGGGGAAGGAGGGAGG + Intergenic
952960668 3:38587361-38587383 ACTGCATGGGGGATGGTGGGGGG - Intronic
953023360 3:39130185-39130207 ACTGGAGAAGGGAGACTGGGGGG - Intronic
953827685 3:46268116-46268138 CATGCAGGAGGGAAGTTAGGAGG + Intergenic
955533263 3:59897043-59897065 ACTGCAGTTGGAAAGGTGGGTGG - Intronic
956630090 3:71308140-71308162 AATGCAGGGGGAAAGATGGGGGG + Intronic
957240109 3:77648872-77648894 ACTGCAAGAGGAAATCTGGGTGG + Intronic
957668513 3:83268925-83268947 ACTAGAGGAGGGAAGAAGGGAGG - Intergenic
957670698 3:83298256-83298278 ACTGCAGAAGGAGAGCTGAGTGG - Intergenic
957730288 3:84125580-84125602 ACTACGGGAGGGAGGCTGAGTGG + Intergenic
959613609 3:108322398-108322420 AGTGCAGGAGAGAATCTAGGGGG + Intronic
959731886 3:109613542-109613564 TCTGCAGGAAGAAAGCTGAGAGG + Intergenic
960153814 3:114277366-114277388 AAAGCAGCTGGGAAGCTGGGTGG + Intronic
960616576 3:119600988-119601010 ACTGCAGGAGGGGAGGAGGGCGG - Intronic
960634282 3:119768296-119768318 AGCACAGGAGGGAAGCTGAGGGG - Intergenic
961395327 3:126583503-126583525 ACTGCAGGATGTTAGCTGTGCGG - Intronic
961511481 3:127406520-127406542 AAGTCAGGAGGTAAGCTGGGAGG - Intergenic
961604832 3:128085861-128085883 CTAGCAGGAGGGAAGCTGGGTGG + Intronic
961605086 3:128087678-128087700 AGAGCAGGAGGGAAGAAGGGAGG + Intronic
961811250 3:129523162-129523184 ACTGCGGGTGGCAAGCAGGGAGG - Intergenic
962275819 3:134012649-134012671 AATGAAGGTGGGAAGCTAGGTGG + Intronic
962418881 3:135209810-135209832 ACTGCAGCATGGAGGATGGGTGG + Intronic
962763876 3:138543283-138543305 AGCGCAGAAGGGAGGCTGGGAGG - Intronic
964073740 3:152667492-152667514 ACTGCAGGAGCCAAGCATGGTGG - Intergenic
964437893 3:156673996-156674018 CTTGCAGAAGGGAAGCTGTGAGG - Intronic
964509843 3:157438286-157438308 CCTAACGGAGGGAAGCTGGGCGG - Intronic
965334216 3:167416200-167416222 ACTTGAGGAGGGAGGGTGGGAGG - Intergenic
965942464 3:174201321-174201343 GCGGGAGGAGGGAAGGTGGGAGG + Intronic
966710300 3:182965992-182966014 ACTGTAGGAGAAACGCTGGGTGG - Intronic
966924709 3:184636760-184636782 CCTGCAGTAAGGAAGCGGGGTGG - Intronic
967873623 3:194251798-194251820 ATGGCTGGAGGGAAGCTTGGAGG - Intergenic
967983136 3:195077521-195077543 ACTCCAGGAGGCTGGCTGGGTGG - Intronic
967983191 3:195077742-195077764 CCTGCAGAAGGGCAGCTGGCAGG + Intronic
968902788 4:3439173-3439195 GCTGCAGTGGGGAAGCAGGGTGG + Intronic
968966337 4:3770807-3770829 GCTGCAGGGGAGAAGCTGGTGGG + Intergenic
970294901 4:14618569-14618591 ATTGGAGGAGGTAAGCTGGTAGG + Intergenic
970381360 4:15511250-15511272 TCTGCAGAAGGGAAGCCAGGTGG - Exonic
971034200 4:22675413-22675435 ACTGAATAAGGGAAGCAGGGAGG - Intergenic
972213708 4:36870544-36870566 ACTGCAGGTGGGAAGGTGAAGGG + Intergenic
972714216 4:41629749-41629771 ACTGCCAGGGGGAAACTGGGGGG - Intronic
974429687 4:61779598-61779620 ACTGCAGCACCGAGGCTGGGTGG - Intronic
975058473 4:69966310-69966332 ACTTGAAGAGGGAATCTGGGTGG + Intergenic
976097862 4:81528247-81528269 AGTACAGGAGGAAAGCTGAGGGG - Intronic
977157119 4:93588613-93588635 ACTTCAGTGGAGAAGCTGGGTGG - Intronic
977437171 4:97012970-97012992 ATAGCAGGAGGGACTCTGGGTGG - Intergenic
977543014 4:98340867-98340889 ACTTGAGGAGGGAGGGTGGGAGG + Intronic
978061408 4:104344776-104344798 CATGCAGGAGGGAGGCTGGGAGG + Intergenic
979118226 4:116855788-116855810 ACTGGAGGCAGGGAGCTGGGTGG - Intergenic
979289610 4:118965376-118965398 AGTGCAGGAGGGATGATGTGAGG - Intronic
979531564 4:121774050-121774072 ACTGAAGGATGGAAGCAGAGAGG + Intergenic
979813185 4:125065093-125065115 ACTGCTGGAGGCAAGCAGGGTGG - Intergenic
979832748 4:125320660-125320682 TCTCCAGGAGGAAAGCTAGGAGG - Exonic
981026126 4:140078549-140078571 GCTGGAGGAGGGAGCCTGGGCGG + Intronic
981520052 4:145651977-145651999 ACAGCAGGGGGGCAGCAGGGGGG - Intronic
981822437 4:148901546-148901568 ACTACTGGAAGGAAGCAGGGAGG - Intergenic
982152112 4:152471462-152471484 AAGGAAGGAGGGAAGCAGGGAGG + Intronic
982187645 4:152819012-152819034 AGTGAAGGAGCAAAGCTGGGTGG - Intronic
982520621 4:156412251-156412273 GCTGCAGAAGGAAAGCTGGAAGG - Intergenic
983219658 4:165032103-165032125 ACTGCTCCAGGTAAGCTGGGAGG + Exonic
983316430 4:166137996-166138018 ACTTGAGTAGGGAAGCTGGGAGG + Intergenic
983662534 4:170144311-170144333 ACTGCGGGGGGAATGCTGGGTGG - Intergenic
983672183 4:170250800-170250822 AGTGAAAGAGGGAAGCTGGAGGG + Intergenic
985149130 4:186928467-186928489 ACTGCAGTTGAGAAGCTGGATGG - Intergenic
985324147 4:188748708-188748730 ACTTGAGGGGGGAAGGTGGGAGG - Intergenic
985526648 5:406383-406405 ACTCCATGTGGGAGGCTGGGAGG + Intronic
985620703 5:953448-953470 ACGGCAGGAAGGAAGCACGGAGG + Intergenic
986100830 5:4609613-4609635 ACTTTAGGAGGGAAGGTGGGAGG + Intergenic
986197918 5:5554944-5554966 ACTGGAGGATGGAAGTTGGGAGG - Intergenic
986262440 5:6160152-6160174 ACAGCAGGAGGGAAGGGGTGTGG - Intergenic
986264073 5:6177578-6177600 ACTGGAGGGTGGAAGGTGGGAGG + Intergenic
986337396 5:6765917-6765939 GCTGCAGCAGGGAGGCTGGCAGG - Intergenic
986557951 5:9030289-9030311 ACAGCAAGAGGGCAGCAGGGAGG - Intergenic
986694373 5:10338984-10339006 AGGGCAGGAGGGAAGTTGGTGGG + Intergenic
987373937 5:17217520-17217542 GCGGGAGGAGGGAGGCTGGGCGG + Intronic
988628780 5:32906581-32906603 AGTTCAGGAGAGAAGGTGGGCGG + Intergenic
990024274 5:51166234-51166256 ACTGGAGGATGGATGGTGGGAGG + Intergenic
990253682 5:53942977-53942999 ACTTCAAGAGGGAAAATGGGAGG + Intronic
990606026 5:57410931-57410953 ATTGCAGGAGTGGAGCTGGCTGG + Intergenic
991136890 5:63192982-63193004 CCTGCAGGAGGGAAGATGGCAGG + Intergenic
991186084 5:63809587-63809609 ACTGGAGGCTGGAGGCTGGGAGG - Intergenic
991296465 5:65086419-65086441 AATTCAGGAGTGAAGCTGTGTGG + Intergenic
992264608 5:75005959-75005981 AATGCAGAAGGGAAGCTCTGGGG + Intergenic
993341956 5:86735703-86735725 ACTTGAGGGTGGAAGCTGGGAGG + Intergenic
994564876 5:101430880-101430902 ACTTAAGGATGGAAGGTGGGAGG + Intergenic
994603330 5:101936359-101936381 ACTTTAGGAGGCAAGGTGGGTGG - Intergenic
994692420 5:103034873-103034895 AGCACAGGAGGGAGGCTGGGAGG - Intergenic
994721677 5:103387519-103387541 ACTTGAGGATGGAGGCTGGGAGG - Intergenic
994958082 5:106561414-106561436 TCTGAAGCTGGGAAGCTGGGAGG - Intergenic
995859857 5:116629668-116629690 ACTGCAGCATGGGAGTTGGGGGG + Intergenic
996662448 5:126020465-126020487 ACAGGAGGAAGGAAGCAGGGAGG - Intergenic
996858265 5:128034638-128034660 ACTTGAGGAGGTAAGGTGGGAGG + Intergenic
997864451 5:137448844-137448866 ACGGGAGGAGGAAAGTTGGGAGG - Intronic
998527896 5:142859187-142859209 GCATCAGGAGGGAAGCGGGGAGG + Intronic
998856117 5:146396701-146396723 TCCCCAGGAGGGCAGCTGGGTGG + Intergenic
999182941 5:149682835-149682857 AGAGCAGGAGGGAGGCTGAGGGG + Intergenic
999208773 5:149869683-149869705 GCTGCAGGAAGGCAGCTGGCAGG + Intronic
999410626 5:151346844-151346866 ACTGCAGGAAGGAGGCAGGGAGG + Intronic
999693787 5:154170680-154170702 ACTGGAGCAGGGAAGGTGGCTGG + Intronic
999717066 5:154369840-154369862 GCAGCAGAAGGGAAGCAGGGAGG - Intronic
1000278097 5:159757166-159757188 AATGCAAGAGGGAAGCTGAAGGG - Intergenic
1000982029 5:167826301-167826323 AATGCAGCAGGGAACCTGGCAGG - Intronic
1001067234 5:168546050-168546072 ACTTGAGGGTGGAAGCTGGGAGG - Intergenic
1001203595 5:169741671-169741693 ACTGTTGGAGGGAAGCTAGAAGG - Intronic
1001507557 5:172292013-172292035 ACTGGAGGAGGGAGAGTGGGAGG - Intergenic
1001639874 5:173236612-173236634 ACCGCGGGCGGGAAGCTGGGCGG + Intergenic
1002064553 5:176645555-176645577 TCTGCTAGAGGGAAGGTGGGTGG + Intronic
1002191865 5:177482552-177482574 AGTGCAGGAGGGAGGCTGGGAGG - Intergenic
1002400932 5:178991285-178991307 GCAGCAGCAGGGAAGGTGGGGGG + Intronic
1002520671 5:179791957-179791979 ACAGGAAGATGGAAGCTGGGTGG + Intronic
1002556757 5:180047840-180047862 AGTGCAGGAGGAAAGCCTGGAGG - Intronic
1002895613 6:1378559-1378581 GCTGCAGGTGGAAAGCAGGGAGG - Intergenic
1003047492 6:2747123-2747145 ACTGCAGGACGGAAGCCAGGAGG + Intronic
1003438943 6:6121941-6121963 AGCACAGGAGGGAGGCTGGGGGG + Intergenic
1003535197 6:6970207-6970229 ATTGGAGGAGGGAGGCTGGAGGG + Intergenic
1004335583 6:14761656-14761678 ACTGGAGGGGGGAAGGTGGGAGG + Intergenic
1004411104 6:15382300-15382322 AGTGCAGGAGGCTAGCAGGGAGG + Intronic
1004871087 6:19904883-19904905 GCAGCATGAGGGAATCTGGGGGG - Intergenic
1005008195 6:21311239-21311261 ACTTCAGGAGGCAAGGCGGGAGG - Intergenic
1005205079 6:23393688-23393710 AAGGAAGGAGGGAAGCTGGGAGG + Intergenic
1005428237 6:25726502-25726524 TCTGGACGAGGGAAGCAGGGAGG - Exonic
1006075532 6:31529833-31529855 AGGGCAGGAGGGAGCCTGGGAGG + Exonic
1006275866 6:33005248-33005270 ACTTTGGGAGGGAAGGTGGGTGG + Exonic
1006404332 6:33835354-33835376 AGAGCAGGTGGGAAGCTGAGGGG + Intergenic
1007249901 6:40488454-40488476 CCTGCAGGAGGGAGGCTTGGAGG - Intronic
1007615790 6:43179281-43179303 GCCGCAGGAGGGAGGCGGGGAGG + Exonic
1007632034 6:43277871-43277893 ACTGGAGGAGAGGAGGTGGGAGG + Intronic
1007649910 6:43412904-43412926 AGCACAGGAGGGAAGCTGAGGGG + Intergenic
1007905601 6:45457411-45457433 ACTGGAGAAGGGAAGGTGGAAGG + Intronic
1007924113 6:45637578-45637600 ACTGCATGCTGGGAGCTGGGGGG - Intronic
1008940364 6:57039955-57039977 CCTGCAGGAAGGAAGATCGGTGG - Intergenic
1009889354 6:69661590-69661612 ACTTGAGGGGGGAGGCTGGGAGG + Intergenic
1010408268 6:75530987-75531009 TCTGTAGGAGGGAAGATGGGCGG - Intergenic
1010692427 6:78926030-78926052 ACTGAAGGATGGAGGGTGGGAGG + Intronic
1010704737 6:79094249-79094271 ACTGCAGGATGGATGCAGTGGGG - Intergenic
1011206019 6:84899026-84899048 CCTGGTGGAGGGAAGATGGGTGG - Intergenic
1012693459 6:102347753-102347775 ACTGGAGGGTGGAAGGTGGGAGG + Intergenic
1013656601 6:112253482-112253504 TCTGCAGCAGGGAAGGTGAGGGG - Intronic
1013908191 6:115240886-115240908 ACTTCAGGAGTGAAGCTTTGTGG + Intergenic
1013963198 6:115926719-115926741 ACTACAGAAAGGAAGCTGGTGGG - Intergenic
1016899911 6:149091222-149091244 CCTGCAGGAGGGAAACAGGGAGG - Intergenic
1016904843 6:149138156-149138178 ACTGCAGGGAGGCAGCAGGGTGG + Intergenic
1016981654 6:149860404-149860426 ACAGCAGGAGGGAGGGAGGGAGG - Intronic
1017126595 6:151070389-151070411 ACTGAAAGAGAGAAGCTGGTTGG - Intronic
1017521316 6:155205692-155205714 GCTGCAGGTGGGATGCTGGCAGG + Intronic
1017812933 6:157997035-157997057 ACTGCAGTCACGAAGCTGGGTGG - Intronic
1018063163 6:160106167-160106189 CATGCTGGAGGGAGGCTGGGCGG + Exonic
1018287631 6:162257799-162257821 ACTGCAGGAGGAAAGGGTGGAGG - Intronic
1018642981 6:165921935-165921957 ACTGCAGGGTAGAAGCTGAGGGG + Intronic
1018901128 6:168052329-168052351 TCTGCAGGAGGTGGGCTGGGAGG - Intergenic
1018924706 6:168198142-168198164 TCTGCAGAAGGGAAGCTGGCTGG + Intergenic
1019255256 7:45734-45756 ATTGCAGAAGGGGAGGTGGGGGG + Intergenic
1019497130 7:1345934-1345956 ACTCCAGGATGGAAGGTTGGGGG - Intergenic
1020721242 7:11748141-11748163 ACTGCAGGAGAGAATGTGTGAGG + Intronic
1021123312 7:16821433-16821455 ACAGCAGGAGGGAAGCTGATGGG + Intronic
1021964738 7:25906202-25906224 ACTGCAGGTGTGAATTTGGGAGG + Intergenic
1022391843 7:29950345-29950367 AGCACAGGAGGGAGGCTGGGAGG + Intronic
1023028527 7:36073560-36073582 ACTGCAGGAGAGAAGGTAGGAGG - Intergenic
1023795299 7:43787524-43787546 ACTGGAGGAGGGACCCAGGGAGG + Intronic
1024812068 7:53223616-53223638 CCTGCAGGAGGGACACTGTGGGG - Intergenic
1026562833 7:71464547-71464569 GCTGAGGGAGGGAAGATGGGGGG - Intronic
1026595743 7:71733010-71733032 AATGAAGGAGGGAAGGAGGGAGG + Intergenic
1029619539 7:101681316-101681338 CCCGCAGGAGGGAAGCCAGGAGG - Intergenic
1029973945 7:104815242-104815264 GCTGCAGCAGGGAGGCGGGGTGG - Intronic
1030174854 7:106641889-106641911 ACAGCATGAGGGAATTTGGGGGG + Intergenic
1032444550 7:131970829-131970851 AGTGCTGGAGAGAGGCTGGGCGG - Intergenic
1032475957 7:132211616-132211638 ACTGCCGCAGGGAGGCTGGGAGG + Intronic
1032582104 7:133112941-133112963 ACTGCAGGAGAGAAGCAATGTGG - Intergenic
1032793744 7:135261052-135261074 GGTGAAGGAGGGAAGCTGCGAGG + Intergenic
1032856095 7:135834808-135834830 ACTGCAGGCAGGAAGGAGGGAGG + Intergenic
1033081526 7:138303339-138303361 ACTGGAGGACAGAAACTGGGAGG + Intergenic
1033490503 7:141838665-141838687 ACTGCAGGGAGGGACCTGGGAGG - Intronic
1034101844 7:148457416-148457438 AGTGTGGGAGGGAGGCTGGGAGG - Intergenic
1034306694 7:150049229-150049251 AGTGCAGGAGGGAGCCGGGGAGG - Intergenic
1034411074 7:150942457-150942479 AGTGCAGGCGGGAGGATGGGTGG + Intergenic
1034435548 7:151061304-151061326 CCGGCAGGAGGGAAGCAGGCTGG - Intronic
1034476524 7:151287543-151287565 ACTGAAGGATGGGAGCTGGAGGG + Intergenic
1034656813 7:152736323-152736345 ACTGTAGGAGCCAAGGTGGGCGG - Intergenic
1035164864 7:156981066-156981088 ACTGCATTAGGGAAAATGGGAGG - Intergenic
1035272356 7:157727993-157728015 TCTGCAGGGTGGGAGCTGGGGGG - Intronic
1035316661 7:158001058-158001080 ACCGCAGGTGGGGAGCAGGGTGG + Intronic
1035565439 8:637710-637732 GGAGCAGGAGGAAAGCTGGGGGG + Intronic
1035938821 8:3873548-3873570 ACTGCAGGGTGGACGGTGGGAGG + Intronic
1036766077 8:11550080-11550102 AGTGCAGGAGGGAGGCTGTGTGG + Intronic
1037048169 8:14336062-14336084 ACTAGAGGATGGAAGGTGGGAGG - Intronic
1037397426 8:18457879-18457901 ACTTGAGGATGGAAGGTGGGAGG + Intergenic
1037960380 8:23093063-23093085 AGGGCAGGAGGGAAGCAGTGGGG - Intronic
1038045755 8:23764368-23764390 GATGCAGGAGGGAGGCTGGACGG + Intergenic
1038087243 8:24212355-24212377 ACTGGAGGGTGGAAGGTGGGAGG - Intergenic
1038157684 8:25006081-25006103 AGGGCAGGAGGGAAGGAGGGAGG + Intergenic
1038574311 8:28690976-28690998 ATTGCAGGGGTGAAGTTGGGGGG + Intronic
1038591901 8:28846917-28846939 AGAGCTGGAGGGAAGCTGGGAGG + Intronic
1039018618 8:33181104-33181126 ACTGGAGGGTGGAAGTTGGGAGG - Intergenic
1042349787 8:67765570-67765592 ACTGCAGAAGAGAGGCAGGGAGG - Intergenic
1043572296 8:81618639-81618661 ATCGCAGAAGTGAAGCTGGGAGG - Intergenic
1044001152 8:86883016-86883038 ACTGGAGGGTGGAAGGTGGGAGG + Intronic
1044483572 8:92722725-92722747 ACTTGAGGAGGGAGGCTAGGAGG + Intergenic
1044645317 8:94436269-94436291 ACTACAGGAGGGAAGGGGGAGGG + Intronic
1045415228 8:101959855-101959877 TCTGCAGTAGGGAGGGTGGGTGG - Intronic
1046449563 8:114370809-114370831 ACTTGAGGATGGAAGGTGGGAGG + Intergenic
1046770533 8:118112279-118112301 TTTGAAGGAGGGAAGCAGGGAGG + Intergenic
1047813898 8:128441537-128441559 ACTGGAGGATGGAGGCTGGGAGG + Intergenic
1048953287 8:139513675-139513697 ACCGCAGGAGGGAAGTGTGGTGG + Intergenic
1049277540 8:141727393-141727415 GCTGCAGAAGGAGAGCTGGGTGG + Intergenic
1049557245 8:143289262-143289284 AGAGCAGGAGGGAAGCGGTGAGG + Intergenic
1049573007 8:143378360-143378382 GCTGCAGGAGGGTGGGTGGGCGG - Intronic
1049982910 9:921152-921174 GCTGGAGGAGGGAGGATGGGGGG - Intronic
1050055469 9:1648526-1648548 ACTGGAGGTGGGAAGGAGGGAGG - Intergenic
1050090972 9:2016343-2016365 ACTGCTGGAGGGAAGGGAGGAGG + Intronic
1050290159 9:4145719-4145741 AAGGGAGGAGGGAAGCTGGCAGG - Intronic
1050712078 9:8476366-8476388 ACAGCAGGAGGTAAGCAGTGGGG - Intronic
1050974973 9:11926467-11926489 ACTTGAGCAGGGAAGGTGGGAGG + Intergenic
1051335491 9:16062396-16062418 ACTTGAGGGTGGAAGCTGGGAGG + Intergenic
1051353846 9:16223296-16223318 CCTACCGGAGGGAAGCTGTGAGG + Intronic
1051581499 9:18680633-18680655 ACTCCAGGAGCTAAGCTGGTAGG - Intronic
1054703356 9:68436359-68436381 ATTGGCGGAGGGAAGCTGGTAGG + Intronic
1055746747 9:79455505-79455527 ATTGGAGGATGGAAGGTGGGTGG - Intergenic
1056055017 9:82812785-82812807 ACTTGTGGATGGAAGCTGGGAGG + Intergenic
1056850503 9:90079970-90079992 CCTGTAGTAGGGAAGCTGAGAGG - Intergenic
1057201571 9:93143234-93143256 ACTGCAGACGGCAAGCAGGGGGG + Intergenic
1057519730 9:95751614-95751636 GCTGCAAGAGGGAGGATGGGAGG + Intergenic
1058884125 9:109310336-109310358 ACTTCAGGAGGGAGGGAGGGAGG + Intronic
1058901774 9:109448272-109448294 ACTGCAGCAGGTAAACTGGTGGG - Intronic
1058957714 9:109964412-109964434 ATTGCAGGAGACCAGCTGGGAGG + Intronic
1059313072 9:113401493-113401515 ACTGCAGGAGGGAGGCCACGAGG + Intergenic
1060193558 9:121608379-121608401 GCTCCAGGAGGGAAGCGGGTTGG + Intronic
1060244211 9:121930562-121930584 TCTGCAGCAGGTAATCTGGGAGG - Intronic
1060258331 9:122052352-122052374 ACTGCAGTCGGGAAGCTGTCTGG - Intronic
1060360330 9:122949815-122949837 ACTGCAGAAGGGAAAGGGGGAGG + Intronic
1060528694 9:124334880-124334902 TCTACAGGAGGGATGCTGTGGGG - Intronic
1060555743 9:124506473-124506495 ACTGCAGGAGGGAAGGGGGTTGG + Intronic
1061236917 9:129348753-129348775 AGTGCGGGAGGGGTGCTGGGAGG - Intergenic
1061237655 9:129351925-129351947 ACTGCAGAAGGAAGGCGGGGAGG - Intergenic
1061282351 9:129604612-129604634 AGGGCAGGAGAGAAGCTGTGGGG + Intergenic
1061483982 9:130911079-130911101 AGCGCAGGAGGGAACCTGAGCGG - Intronic
1061957872 9:133973026-133973048 TCTCCAGGAGGGAGGCTGGTTGG - Intronic
1062217411 9:135396769-135396791 TCTGCAGGACTGAGGCTGGGAGG + Intergenic
1062686592 9:137816915-137816937 TCTGGAGGAGGGCGGCTGGGCGG - Intronic
1062729810 9:138102632-138102654 GCAGCAGGAGGGGAGCGGGGAGG - Intronic
1203568118 Un_KI270744v1:108744-108766 AAGGCTGGAGAGAAGCTGGGAGG + Intergenic
1186253652 X:7697045-7697067 ATTGCAGGATGTAAGCTGAGAGG - Intergenic
1187498213 X:19814484-19814506 ACTGCCGGAGGGAAGAGGGCAGG - Intronic
1188295920 X:28448118-28448140 ACTGGAGGGTGGAAGATGGGAGG + Intergenic
1188982637 X:36740639-36740661 ACTTCAGGATGGAGGGTGGGAGG - Intergenic
1189685663 X:43561304-43561326 ATTGGAGGATGGAAGGTGGGAGG - Intergenic
1189858000 X:45242896-45242918 ACTGGAGGATGGAGGATGGGAGG - Intergenic
1190301902 X:49062008-49062030 ACAGCAAGTGGGGAGCTGGGCGG - Exonic
1190534196 X:51409196-51409218 ATGGGAGTAGGGAAGCTGGGAGG + Intergenic
1191637436 X:63393386-63393408 CCTCCAGGAGGGAGGTTGGGGGG + Intergenic
1192223010 X:69210190-69210212 ACTGCAGAAGTGAAGGGGGGTGG + Intergenic
1192496682 X:71620919-71620941 ACAGCAGGAGGTAAGCTGCAGGG - Intergenic
1192955728 X:76068529-76068551 ACAGCATGATGGAAGCTGGAAGG + Intergenic
1193289690 X:79757171-79757193 ACTTCAGGATGGAGGGTGGGAGG - Intergenic
1194540435 X:95163450-95163472 ACTTGAGGAGGGATGGTGGGAGG + Intergenic
1195275241 X:103275159-103275181 ACTGCAAGAGGGAGGATTGGAGG + Intronic
1195671956 X:107477337-107477359 AATGCAGGAGGGGGGCTGGGGGG + Intergenic
1195935740 X:110124236-110124258 ACGGAAAGAGGGAAGCAGGGAGG + Intronic
1198030577 X:132750071-132750093 ACTTCAAGAAGGAAGCTGGGGGG - Intronic
1198089258 X:133311678-133311700 ACTCCAGGAGGGAAGGGGGTGGG - Intronic
1198141772 X:133811280-133811302 AAAGGAGGAGGGAAGGTGGGAGG + Intronic
1198243553 X:134807726-134807748 ACTGGAGGAGGCAAGCGGTGGGG + Intronic
1198954669 X:142115218-142115240 ACTTGAGGAGGGATGGTGGGAGG + Intergenic
1199529668 X:148832173-148832195 ACTGAAGGAAGGAAGGAGGGAGG + Intronic
1200058312 X:153472861-153472883 CCTGGAGGAGGGATGTTGGGGGG + Intronic
1201180041 Y:11334115-11334137 ACTCCATGGGGGCAGCTGGGAGG - Intergenic
1201771728 Y:17622521-17622543 ACTGAAGGTGGGGAGCTGGCTGG + Intergenic
1201829827 Y:18283465-18283487 ACTGAAGGTGGGGAGCTGGCTGG - Intergenic
1202079646 Y:21071315-21071337 AGTGCAGGAGGGGGGCTGGTGGG + Intergenic