ID: 1138244987

View in Genome Browser
Species Human (GRCh38)
Location 16:55460720-55460742
Sequence CACTCAGCTCTTTCTCCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 355}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138244987_1138244993 23 Left 1138244987 16:55460720-55460742 CCGCAGGGAGAAAGAGCTGAGTG 0: 1
1: 0
2: 2
3: 47
4: 355
Right 1138244993 16:55460766-55460788 GCCCCGCCGCTGGCCTCCTAGGG 0: 1
1: 0
2: 1
3: 8
4: 128
1138244987_1138244991 13 Left 1138244987 16:55460720-55460742 CCGCAGGGAGAAAGAGCTGAGTG 0: 1
1: 0
2: 2
3: 47
4: 355
Right 1138244991 16:55460756-55460778 TGATTTTCAAGCCCCGCCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 43
1138244987_1138244992 22 Left 1138244987 16:55460720-55460742 CCGCAGGGAGAAAGAGCTGAGTG 0: 1
1: 0
2: 2
3: 47
4: 355
Right 1138244992 16:55460765-55460787 AGCCCCGCCGCTGGCCTCCTAGG 0: 1
1: 0
2: 0
3: 19
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138244987 Original CRISPR CACTCAGCTCTTTCTCCCTG CGG (reversed) Intronic
900226597 1:1536076-1536098 CACTCAGCACCTCCTCCCTGAGG + Intronic
900313442 1:2045822-2045844 CACAGAGCCCTTGCTCCCTGGGG + Intergenic
901198721 1:7454682-7454704 TACTCAGCTCTCTCCTCCTGAGG + Intronic
901266110 1:7912077-7912099 GGCTCATCTCTTTCTCACTGTGG + Intergenic
901874250 1:12157948-12157970 CACTCAACTCTCTGTACCTGAGG + Intergenic
903478719 1:23637982-23638004 CACCCAGCTCTGTCTCTGTGGGG + Intronic
903862127 1:26370860-26370882 CACTCAGCTTTGCCTACCTGTGG + Intronic
904324893 1:29722004-29722026 CTCTCAGCTCTGTCTCCTTCTGG + Intergenic
904349580 1:29896189-29896211 GAGTCCGCTCTGTCTCCCTGAGG - Intergenic
904425009 1:30417429-30417451 GACTTAGCTGTTTCTGCCTGTGG - Intergenic
904563134 1:31412148-31412170 CAACCAGCTCTTTGGCCCTGGGG + Intronic
904746782 1:32716367-32716389 CACACACCTCTCTCTACCTGTGG - Intergenic
905186879 1:36203432-36203454 GACTCAGCCCTTTGTGCCTGAGG - Intergenic
906218310 1:44057662-44057684 CAACAAACTCTTTCTCCCTGAGG + Intergenic
906705905 1:47895156-47895178 AACTCAGGTCTTCCTCCCTGTGG - Intronic
907564085 1:55418318-55418340 CTCTCGGCTCCTTCTCACTGAGG - Intergenic
908558437 1:65281450-65281472 CACTAATCTATTTGTCCCTGCGG + Intronic
909677204 1:78251966-78251988 CAAGCAGAGCTTTCTCCCTGTGG + Intergenic
910100875 1:83574913-83574935 CAATCAGCTCTTTCTACCAAAGG - Intergenic
910243084 1:85109508-85109530 CCCTCAGCCCTTTCTCCTTCAGG - Intronic
910433524 1:87181859-87181881 CTCTGAGCTTTTTCTCCATGGGG + Intergenic
910760099 1:90724869-90724891 CACTCACATTTTTCTCTCTGAGG + Intergenic
912524744 1:110273195-110273217 CACACAGCACTTTCTCTCTAGGG - Intronic
912961488 1:114199508-114199530 TACTCAGCCCTTTTTCCATGTGG - Intergenic
913449300 1:118982164-118982186 CAATCTGCCCTTTATCCCTGTGG + Intronic
915118759 1:153615772-153615794 CACTCCTCTCCTTCACCCTGAGG - Intronic
917407581 1:174723804-174723826 CACACAGCTCTTTGTACCTCAGG + Intronic
918070119 1:181128547-181128569 CACTCCTCTCCTTCTTCCTGAGG + Intergenic
918217539 1:182405664-182405686 CCCTCAAATCTATCTCCCTGAGG - Intergenic
918998997 1:191803620-191803642 CATTCTACTCTATCTCCCTGAGG + Intergenic
919850259 1:201667705-201667727 AACTCACCTCTCCCTCCCTGTGG + Intronic
920246765 1:204593634-204593656 CACTGAGCTCTTTCGCACTACGG - Intergenic
920730845 1:208482757-208482779 AAGTCACCTCTTTATCCCTGAGG - Intergenic
920824871 1:209415897-209415919 CACTCTACTCTTGCTCTCTGTGG + Intergenic
921181822 1:212637380-212637402 CATGTAGCTCATTCTCCCTGTGG - Intergenic
922287432 1:224182765-224182787 CACTCTGCATTTTTTCCCTGAGG + Intronic
923069010 1:230545823-230545845 GACTCAGACCTTTATCCCTGAGG - Intergenic
923887636 1:238176880-238176902 CACTCAGTTCCTTCTTGCTGTGG + Intergenic
924650907 1:245926455-245926477 GACTCAGATATTTTTCCCTGTGG - Intronic
924661127 1:246018190-246018212 TACACAGCTCTTTCTCTCTGTGG + Intronic
1063611289 10:7563863-7563885 GACACAGCTCTTTATTCCTGTGG - Intronic
1063682853 10:8206841-8206863 CACTCTGCTCTTTCAGCCAGAGG - Intergenic
1065371061 10:24987041-24987063 CTCCCAGCTCTTTCGCCCTCTGG + Intronic
1066366472 10:34781656-34781678 CACTCAACTTTTCCTCCCAGAGG - Intronic
1069291755 10:66788634-66788656 CATTTAGCTCTGTTTCCCTGGGG - Intronic
1069904136 10:71722565-71722587 CACAAAGCCCTTTCTTCCTGTGG + Intronic
1071256312 10:83875036-83875058 CACTTAGCTCTTCTTCCGTGTGG + Intergenic
1072072566 10:91933418-91933440 CTCTCATCAGTTTCTCCCTGAGG - Intronic
1073287433 10:102397250-102397272 CATGCAGTTCTTTCTTCCTGAGG - Intronic
1074085136 10:110204091-110204113 CTCACAGCTCCTTCTCCTTGGGG - Intergenic
1074189473 10:111123525-111123547 CACTCAGCCCTGTGTGCCTGTGG + Intergenic
1075361924 10:121846039-121846061 GAATCAGCTATTTCTCCTTGGGG - Intronic
1075733634 10:124651180-124651202 CACCTGGCTCTGTCTCCCTGTGG - Intronic
1075909930 10:126115433-126115455 CAGTCAGCTCGTTCTCTCTGTGG - Intronic
1076254664 10:129012533-129012555 CAGACAGGCCTTTCTCCCTGGGG - Intergenic
1076372454 10:129964249-129964271 AACTCAGCCCTCTCTCCCCGAGG + Intergenic
1076545684 10:131244579-131244601 CAGTGAGCTCTCACTCCCTGTGG + Intronic
1076801449 10:132832421-132832443 CACCCAGGTCTTACTCTCTGGGG - Intronic
1077681230 11:4242544-4242566 CACTTAGCCCTTTTTTCCTGAGG + Intergenic
1078524854 11:12092491-12092513 AAATCAGTTGTTTCTCCCTGGGG + Intergenic
1079187485 11:18250022-18250044 CTGTGAGCTCTTTTTCCCTGGGG - Intergenic
1080792031 11:35529966-35529988 TCCTCTGCTGTTTCTCCCTGTGG - Intronic
1081658673 11:44874618-44874640 CATTTTCCTCTTTCTCCCTGGGG - Intronic
1082707657 11:56512448-56512470 CACAAAGCTTTTTCTACCTGTGG - Intergenic
1083796726 11:65021272-65021294 AACCCTGCTCTTTCTCACTGTGG - Intronic
1084125954 11:67099136-67099158 CCACCAGCTCTTTCTCCCCGGGG + Intergenic
1084773134 11:71357231-71357253 CACTCATTTCCTTCTCCCTGAGG - Intergenic
1085029598 11:73262867-73262889 CACTCTGCACGTTCTCCCTGGGG - Intergenic
1085798767 11:79567840-79567862 CATTCAGCTGTTTGTCCCTATGG - Intergenic
1085880260 11:80459191-80459213 GACTTCGCTCTGTCTCCCTGGGG + Intergenic
1088396805 11:109378136-109378158 CTCTCAGCTGTTTCTCTCTTTGG - Intergenic
1089139158 11:116272480-116272502 CCATCAGCTCTTTGTCTCTGAGG - Intergenic
1089158116 11:116417381-116417403 CCCTCAGCTGTTGCTTCCTGTGG + Intergenic
1089871594 11:121677911-121677933 CACTAAACTCTTTCCCCCTAAGG - Intergenic
1091160326 11:133413981-133414003 CCCTCTCCTCTTACTCCCTGAGG + Intronic
1091393915 12:142130-142152 CTCTCCCCTCTTTCTCCTTGGGG + Intronic
1091611033 12:2009689-2009711 CAATTAACTCTCTCTCCCTGTGG + Intronic
1091644888 12:2265801-2265823 CACCCAGCTCTCCCTCTCTGTGG - Intronic
1091849873 12:3686999-3687021 CACCCTGCCCTTTCTCCCTGTGG + Intronic
1095983679 12:47986328-47986350 CACTTAACTCTTTCTCCAGGGGG + Exonic
1096529831 12:52235529-52235551 CTCTCTCCTCTTTGTCCCTGGGG + Intronic
1097088318 12:56486184-56486206 CTCTCAACCCTTTCTGCCTGGGG + Intronic
1097805649 12:63961761-63961783 GAATCAGCTCTTTCTCCTTCTGG - Intronic
1099955395 12:89348653-89348675 CATACTGCTCTTTCTCCCTTTGG + Exonic
1102960725 12:117091718-117091740 TACTGAGCTTGTTCTCCCTGGGG + Intronic
1103196153 12:119045382-119045404 CACTCTGCCCTTTCTCCTTATGG - Intronic
1103978053 12:124716636-124716658 CACTCAGCACATTCTCCTTATGG + Intergenic
1105060544 12:133146351-133146373 CACACAGCTCACCCTCCCTGGGG + Intronic
1105391959 13:19987991-19988013 CACACAGCTCTTTCTCTGAGAGG + Intronic
1105884814 13:24632608-24632630 GACTCTCCTCTTGCTCCCTGTGG - Intergenic
1105955788 13:25281508-25281530 CAGACACCTCTTTATCCCTGAGG + Intronic
1107232121 13:38122561-38122583 CACTCAGCTCTTTGTATTTGCGG - Intergenic
1109058619 13:57583169-57583191 CTCTCAGCTTTTTCTCTCTGAGG + Intergenic
1109666531 13:65546774-65546796 CACTGGGCTCTTTTTCCCTAAGG + Intergenic
1110870806 13:80450593-80450615 CACTCAGCTTCCTCACCCTGTGG - Intergenic
1112646058 13:101333413-101333435 CCCTCAGCTCTCACTCCCTTAGG - Intronic
1113900314 13:113793226-113793248 CCCTGAGCTCTGTCTCCCAGTGG - Intronic
1114004496 14:18298071-18298093 CACTCAGCACATTCTCACTAAGG - Intergenic
1114689895 14:24571492-24571514 CATTCAGCCCTTCCTCCCTGTGG - Intergenic
1114894096 14:26964049-26964071 CACTCGTCTCTATCCCCCTGGGG - Intergenic
1115705961 14:35998482-35998504 GACTCAGCTCTTTTCCCCTTTGG - Intergenic
1117306082 14:54474443-54474465 TACTCACCTCTTTCCCCCTTTGG - Intergenic
1117329989 14:54702884-54702906 CACCCATGTCTTTCACCCTGGGG + Intronic
1118582701 14:67319216-67319238 CCCTCAGCTCTATTTCCATGAGG - Intronic
1119628580 14:76205874-76205896 CACACAGGTTTTTCCCCCTGGGG + Exonic
1120522920 14:85545843-85545865 GATTCACCTCTTTTTCCCTGTGG + Intronic
1120832279 14:89008209-89008231 CACACAGATCTCTCTCCCTGAGG - Intergenic
1121476465 14:94211473-94211495 CACCCAGCTCTTTCACCTTAGGG - Intronic
1122997969 14:105275901-105275923 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122997980 14:105275954-105275976 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122997993 14:105276007-105276029 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998004 14:105276060-105276082 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998017 14:105276113-105276135 CTCTCGGCTCCTTCTCACTGTGG - Intronic
1122998029 14:105276166-105276188 CTCTCGGCTCCTTCTCACTGTGG - Intronic
1122998041 14:105276219-105276241 CTCTCGGCTCCTTCTCACTGTGG - Intronic
1122998055 14:105276272-105276294 CTCTCGGCTCCTTCTCACTGTGG - Intronic
1122998067 14:105276325-105276347 CTCTCGGCTCCTTCTCACTGTGG - Intronic
1122998079 14:105276378-105276400 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998092 14:105276431-105276453 CTCTCGGCTCCTTCTCACTGTGG - Intronic
1122998104 14:105276484-105276506 CTCTCGGCTCCTTCTCACTGTGG - Intronic
1122998118 14:105276537-105276559 CTCTCGGCTCCTTCTCACTGTGG - Intronic
1122998130 14:105276590-105276612 CTCTCGGCTCCTTCTCACTGTGG - Intronic
1122998144 14:105276643-105276665 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998155 14:105276696-105276718 CTCTCGGCTCCTTCTCACTGTGG - Intronic
1122998167 14:105276749-105276771 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998178 14:105276802-105276824 CTCTCGGCTCCTTCTCACTGTGG - Intronic
1122998190 14:105276855-105276877 CTCTCGGCTCCTTCTCACTGTGG - Intronic
1122998202 14:105276908-105276930 CTCTCGGCTCCTTCTCACTGTGG - Intronic
1122998218 14:105276961-105276983 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998231 14:105277014-105277036 CTCTCGGCTCCTTCTCACTGTGG - Intronic
1122998243 14:105277067-105277089 CTCTCGGCTCCTTCTCACTGTGG - Intronic
1122998255 14:105277120-105277142 CTCTCGGCTCCTTCTCACTGTGG - Intronic
1122998271 14:105277173-105277195 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998284 14:105277226-105277248 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998297 14:105277279-105277301 CTCTCGGCTCCTTCTCACTGTGG - Intronic
1122998309 14:105277332-105277354 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998322 14:105277385-105277407 CTCTCGGCTCCTTCTCACTGTGG - Intronic
1122998334 14:105277438-105277460 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998347 14:105277491-105277513 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998358 14:105277544-105277566 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1123061177 14:105595199-105595221 CACTGAGCTCTGTCCCCCGGGGG + Intergenic
1123085632 14:105716110-105716132 CACTGAGCTCTGTCCCCCGGGGG + Intergenic
1123448992 15:20348904-20348926 CCCTCAGCTCTTCCTCCCCCAGG - Intergenic
1124162885 15:27289990-27290012 GAATCAGCTCTTTCTCCAAGGGG - Intronic
1124166183 15:27327842-27327864 CACTCTGCTCTTTCTGCCTCAGG + Intronic
1124237686 15:28004058-28004080 CACCCTGCTCTTCCTTCCTGTGG + Intronic
1125335244 15:38620216-38620238 GTCTCAGTTCTTTCTCCATGGGG - Intergenic
1127250639 15:57233531-57233553 CTCTCAGCTCTCTCACTCTGTGG + Intronic
1127453959 15:59141271-59141293 AACTCATCCCTATCTCCCTGGGG + Intronic
1127455786 15:59155014-59155036 CATTCAGCTCTCACTCACTGAGG - Intronic
1127969871 15:63949800-63949822 CACTCATCTCTTTCAGCCTTGGG + Intronic
1130576716 15:85099379-85099401 CACACAGATCCATCTCCCTGAGG - Intronic
1130584532 15:85170805-85170827 GACTCAGCTCTCTCAGCCTGTGG + Intergenic
1130584543 15:85170916-85170938 GACTCAGCTCTCTCAGCCTGTGG + Intergenic
1130689882 15:86072953-86072975 CCCTCAAATCTGTCTCCCTGAGG - Intergenic
1131400235 15:92119578-92119600 CACCCAGGTCTTTGTCCTTGGGG - Intronic
1131577465 15:93606193-93606215 CCCTCAGCCCTTTTTGCCTGAGG - Intergenic
1132490785 16:229437-229459 CACTCGGCTCTTTCCCGCCGCGG + Exonic
1133099685 16:3471617-3471639 CTCTCAGGTGGTTCTCCCTGTGG + Intronic
1133160066 16:3905205-3905227 CACTCAATGCTTGCTCCCTGGGG + Intergenic
1134142781 16:11736176-11736198 CTGTCAGCTTTTTCTCCTTGAGG - Exonic
1134239877 16:12497777-12497799 CAATATGCTCTTTCTGCCTGAGG - Intronic
1134334143 16:13279728-13279750 AAATCACTTCTTTCTCCCTGTGG + Intergenic
1135803449 16:25520491-25520513 CCCTCAGTTCTTTCTGCCTGGGG + Intergenic
1138244987 16:55460720-55460742 CACTCAGCTCTTTCTCCCTGCGG - Intronic
1138913275 16:61429365-61429387 CACCCAGCACTTTCTCACTGTGG + Intergenic
1139745716 16:69072833-69072855 TATTCTGCTCTTTCTCCGTGTGG - Intronic
1140112877 16:72018586-72018608 CACCCAGCCCTCCCTCCCTGTGG + Intronic
1141239175 16:82249110-82249132 TAATCAGCTCTTTCTTACTGTGG + Intergenic
1141616929 16:85215020-85215042 CACTCAGCTCTTTCTTCTCTGGG - Intergenic
1142282827 16:89157367-89157389 CACTCACCACCTTCTCACTGTGG - Intergenic
1143371958 17:6445839-6445861 CACTCAGCTGTGTATCCCTGAGG + Intronic
1144355598 17:14443162-14443184 CCCTCAGATCTTTCTCCAGGGGG + Intergenic
1144484128 17:15651084-15651106 CACTCACCTCCTTGTCCCTGCGG + Exonic
1147261746 17:39212988-39213010 CACTCACCTGGTTCTCCTTGAGG + Exonic
1147528541 17:41251020-41251042 CACGCAGCTGTTTCTCACTGAGG - Intronic
1147916797 17:43892608-43892630 CAGTAACTTCTTTCTCCCTGTGG - Intronic
1147944713 17:44074398-44074420 AACTCAGCTTGGTCTCCCTGGGG - Intronic
1148123728 17:45226328-45226350 CACAGAGCTCTTACTCACTGGGG - Intronic
1148797773 17:50205345-50205367 CACCCAGCCCTTACACCCTGAGG - Intergenic
1149222032 17:54426161-54426183 CATTCTTCTGTTTCTCCCTGTGG - Intergenic
1150221217 17:63496918-63496940 CATGCAGCTCGTTCTCCGTGCGG - Exonic
1150592911 17:66578871-66578893 CACTCATCTGTTTCGACCTGTGG + Intronic
1152186802 17:78862234-78862256 CACTCAGCTCTGGCTGGCTGTGG - Intronic
1152339658 17:79716960-79716982 CCCTCAGCTCTTCCTCCCCCAGG + Intergenic
1153161741 18:2213147-2213169 CACTCTTCCCTTTCTCCCTCTGG - Intergenic
1153694529 18:7626983-7627005 CACTCAGCTCACTCTCCCCTCGG + Intronic
1153708725 18:7775249-7775271 CATTGAGCTCTTTATCACTGTGG + Intronic
1153988900 18:10377693-10377715 CCCTCTGCCCTTTCTTCCTGGGG + Intergenic
1155417606 18:25616783-25616805 CACTCAGCTGACTCTCTCTGCGG - Intergenic
1156131578 18:33982578-33982600 GACTAATCTATTTCTCCCTGTGG - Intronic
1157496418 18:48160771-48160793 CTCTCAGGTGTCTCTCCCTGCGG - Intronic
1159389550 18:67771734-67771756 CACTCATCTCTCTCACCCTGTGG + Intergenic
1160253955 18:77231207-77231229 ACCTCAGCTCTTTCTCCCCCAGG - Intergenic
1160336958 18:78050708-78050730 CTCTCAGCCCTGTCTCCTTGAGG - Intergenic
1160380112 18:78448201-78448223 CACTCAGCTCTTTGTCCCCAGGG + Intergenic
1160527949 18:79548213-79548235 CCCTCCGCTCTGTCTCGCTGGGG + Intergenic
1161106927 19:2448350-2448372 CAGTCAGCTCTCTCTCTGTGGGG - Intronic
1165368800 19:35389039-35389061 CACTCAAATCAGTCTCCCTGAGG - Intergenic
1165378730 19:35462556-35462578 CACTAAGCTCCTTCTCCTTGTGG + Intergenic
1165657276 19:37544934-37544956 CATTTAGCTGTTTCTCCCTGGGG - Intronic
1165890933 19:39111873-39111895 CAGCCAGCTCTTTCTCACTGCGG + Intergenic
1167300707 19:48675897-48675919 AGCTCAGCTCCTTCTCCGTGGGG + Intergenic
1167785915 19:51636237-51636259 CACTGAGCTCTACCTCTCTGAGG + Intronic
925388525 2:3480039-3480061 CACTCAGCTCACTCTCCACGTGG - Intronic
925406711 2:3610448-3610470 CAGTCTGCTCTTTCTCCCACTGG - Intronic
925856917 2:8138009-8138031 CACTCAGCGGTTTCTGCGTGGGG - Intergenic
925895880 2:8471589-8471611 TACTCAGTTATTTTTCCCTGAGG - Intergenic
926207823 2:10846601-10846623 CTCACAGCTCATTTTCCCTGCGG - Intergenic
928467471 2:31535840-31535862 CACTCTGTTCTTTTTCCCTCTGG - Intronic
928558455 2:32450986-32451008 CACTCAGCTCTCTGTATCTGTGG - Intronic
929564776 2:42977471-42977493 CTCCCAGCCCTTCCTCCCTGTGG - Intergenic
930096848 2:47571729-47571751 GCCTGGGCTCTTTCTCCCTGTGG - Intergenic
930643246 2:53876303-53876325 GACACAGCTTTTTTTCCCTGAGG - Intronic
930754428 2:54960496-54960518 CACCCAGCTGGTTCTTCCTGGGG - Intronic
933796839 2:85926788-85926810 CACTCAGCTTTTTCTACTTCAGG + Intergenic
933895968 2:86809614-86809636 TGCTCACCTCTTCCTCCCTGCGG - Intergenic
933934624 2:87192155-87192177 CACTGAGCTCCTTTTCACTGTGG + Intergenic
935083996 2:99826955-99826977 CTGTCAGCTCTGTCTCCCTCCGG - Intronic
935930312 2:108117089-108117111 CAAACACCCCTTTCTCCCTGCGG + Intergenic
936358519 2:111773741-111773763 CACTGAGCTCCTTTTCACTGTGG - Intronic
936481000 2:112884663-112884685 AAATCAGCGATTTCTCCCTGTGG + Intergenic
936849832 2:116882311-116882333 ATCTCAGCTCTTACACCCTGGGG + Intergenic
937229583 2:120389690-120389712 TACCCTGCCCTTTCTCCCTGAGG - Intergenic
937278557 2:120702104-120702126 GAATCAGCTCTTTCTAACTGAGG + Intergenic
937332041 2:121037711-121037733 CCCTGAGCTCTTTCTACCTGGGG + Intergenic
938613109 2:132969512-132969534 ACCTCAGCTCTCTCACCCTGGGG - Intronic
939038433 2:137160353-137160375 CACTCACCTTTTTTCCCCTGAGG - Exonic
941838329 2:170051190-170051212 CAGTCAGCTCTTTGTACCTGTGG - Intronic
944074055 2:195707188-195707210 CACTTAGCTCTTTATACATGGGG + Intronic
944176862 2:196839744-196839766 CTCTCAGCTGTTACTGCCTGTGG - Exonic
945731501 2:213541872-213541894 CACTGAGTTCTTCCTCACTGGGG + Intronic
946028857 2:216689635-216689657 GACTCAGCTCTTTCCCGCAGGGG - Intronic
947345010 2:229181268-229181290 CCCTGGGCTCTTTCTCCCTTCGG - Intronic
947637796 2:231688890-231688912 CCTTCAGCACTTGCTCCCTGAGG - Intergenic
947749850 2:232526355-232526377 CACTCTGCCATCTCTCCCTGTGG + Intronic
948272040 2:236682101-236682123 CATTCAGCTCTCTCTCACTTAGG + Intergenic
948758306 2:240172335-240172357 TGCTCAGCTCATTCTCCCTAAGG - Intergenic
949009774 2:241671849-241671871 TCCTCATCTCTGTCTCCCTGTGG + Intronic
1169257628 20:4111054-4111076 CGCTCAGCCCTTTCTGCCTCTGG + Intergenic
1170967045 20:21082893-21082915 GACCCAGATCTTTGTCCCTGAGG - Intergenic
1171240799 20:23565689-23565711 CAGACTGCTCTTTCCCCCTGGGG - Intronic
1171878931 20:30602544-30602566 CACTCAGCTCATGCTCCTGGAGG - Intergenic
1172645970 20:36469839-36469861 CCATCTGCTCCTTCTCCCTGGGG + Intronic
1172893571 20:38283950-38283972 CACTCCCCTCATTCTCCTTGGGG - Intronic
1173387974 20:42606176-42606198 CACTCACCTCTAATTCCCTGAGG + Intronic
1174043373 20:47715548-47715570 CACTCAGCTGTGTCTCCCACAGG - Intronic
1175884236 20:62279830-62279852 TTCTCAGCTCTCTCCCCCTGTGG - Intronic
1176670347 21:9728360-9728382 CTCTTTGCTCTTTCTCCATGTGG - Intergenic
1178377073 21:32075586-32075608 CCTTCAACTCTTTCTCACTGTGG - Intergenic
1180260269 21:46663597-46663619 CACCCAGGCCTGTCTCCCTGAGG - Intronic
1180429012 22:15228861-15228883 CACTCAGCACATTCTCACTAAGG - Intergenic
1181493189 22:23273608-23273630 AACTCAAGTCTTTCTTCCTGGGG + Intronic
1181525682 22:23484388-23484410 CGCTCTGCCCTCTCTCCCTGTGG - Intergenic
1181968321 22:26671922-26671944 CACACAGATCCTTCTGCCTGGGG + Intergenic
1183783053 22:40010985-40011007 CAATCAGCTCTTTGCACCTGGGG - Intronic
1185318305 22:50188550-50188572 CACGCAGCTCTTGCTCCCCCGGG - Intronic
1185340856 22:50290479-50290501 GGTTCAGCTCTTTCTCGCTGCGG + Exonic
949376217 3:3393038-3393060 CTCCCACCTCTTCCTCCCTGGGG + Intergenic
950099157 3:10346537-10346559 TAGCCAGCACTTTCTCCCTGGGG + Intronic
950259735 3:11535340-11535362 TACTCATCTCTGTCTCCCAGTGG + Intronic
950485769 3:13273331-13273353 CACTCCCCTCTTTCACCTTGAGG - Intergenic
950854664 3:16093845-16093867 GAGTCTGCTCTTTCTCTCTGGGG + Intergenic
951145937 3:19227243-19227265 CACTCATTTCTTTCCACCTGGGG + Intronic
951230921 3:20178964-20178986 CTCTCAGCTCTTTCTACCCCCGG - Intronic
952161793 3:30701130-30701152 CCCACAACTCTTTCTCCCTCAGG + Intergenic
952457838 3:33490805-33490827 CACTCTGCTCTACCTCCCTTGGG + Intergenic
952594923 3:35005752-35005774 CCCTCAACTCTATCTCCCTGAGG + Intergenic
953211310 3:40877710-40877732 CACTCAGGCCATTCTCCCTCTGG - Intergenic
953458241 3:43061044-43061066 CACTGACCTCTTCCTACCTGGGG + Intergenic
953548207 3:43880191-43880213 AACTCAGCTCTATCTACCTTAGG + Intergenic
954093764 3:48306376-48306398 CACTGAGAACTTTTTCCCTGGGG - Intergenic
955392435 3:58531262-58531284 GACTCAGCATGTTCTCCCTGGGG + Exonic
959500680 3:107102875-107102897 CACCCAGCTCTTCCCTCCTGGGG + Intergenic
959894722 3:111593574-111593596 CAGGCAGCTCTTTCTCCCGCTGG + Exonic
961641024 3:128364928-128364950 CCCTCTGCTCGATCTCCCTGGGG - Intronic
961930194 3:130524919-130524941 CATTCATCTCTTTTTCCCTAGGG - Intergenic
962785930 3:138768433-138768455 CACACACTTCCTTCTCCCTGAGG - Intronic
963213142 3:142716445-142716467 CCCTCCTCTCTTTCTCCCAGAGG - Intergenic
963590896 3:147257091-147257113 CAATCAGCCCTTTCTCCCACTGG + Intergenic
964530662 3:157664218-157664240 CATTCAGTGCTTTCTCCCTAGGG - Intronic
964868689 3:161289633-161289655 CAATCAGCTCTGTCTGCCAGAGG + Intergenic
967575494 3:191085897-191085919 CTCTCAGATCCTTCTCCCAGAGG - Intergenic
969057780 4:4413039-4413061 CATTCAGCTCTTCCTCCCTTGGG + Intronic
969434985 4:7183927-7183949 CCCTCAACTCTTTGACCCTGTGG - Intergenic
970191717 4:13524226-13524248 CAATCAGCTCTGTCTCTATGCGG + Intergenic
970501684 4:16683840-16683862 GACCCAGCTCTTCCTTCCTGTGG + Intronic
971346703 4:25818189-25818211 CTTTCAGCTCCTTCTCCCAGGGG + Exonic
971454894 4:26834974-26834996 CCCTTAGCCCTTACTCCCTGTGG + Intergenic
971732679 4:30406396-30406418 CAGCCTGCACTTTCTCCCTGGGG - Intergenic
971826575 4:31631050-31631072 CACTCAGCTGTTACTCCATGTGG - Intergenic
972292218 4:37699685-37699707 CTCTCTTCTCTTTCTCCCAGGGG + Intergenic
973051260 4:45601067-45601089 TATTCACCTCTTTCTGCCTGGGG - Intergenic
973202715 4:47522458-47522480 TTCTCAGCTCTTTCTTCCTGTGG - Intronic
975388630 4:73788953-73788975 TTCTCAGGTCTTTCTCACTGGGG + Intergenic
977858205 4:101921976-101921998 TACACTGCTCTTTGTCCCTGTGG + Intronic
979170372 4:117594579-117594601 CACTCAGCTCTTTGCACCTTTGG - Intergenic
979267114 4:118716497-118716519 CACTGAGCTCTTTCCCCATGAGG - Intergenic
980516320 4:133867152-133867174 CACTCCCCTAGTTCTCCCTGTGG + Intergenic
981616113 4:146646681-146646703 CACTAAGCTGGTTCTTCCTGTGG - Intergenic
985404430 4:189623174-189623196 CTCTTTGCTCTTTCTCCATGTGG + Intergenic
985430703 4:189876975-189876997 CCCTCAGGTCTTCCTGCCTGTGG - Intergenic
985504141 5:269071-269093 CACTGAGCTGTTTCTTGCTGAGG + Intergenic
985922402 5:2987819-2987841 CAATCAGTTCTTTTTCTCTGGGG + Intergenic
986720487 5:10557573-10557595 CACTCAGCTTATTCTCTCTTAGG - Intergenic
987108357 5:14662830-14662852 CACTCAGATCCTTCTCACGGTGG + Intergenic
990834727 5:60004555-60004577 CACTCAGCCCTTTGTATCTGTGG - Intronic
993133612 5:83929679-83929701 CACTCACCTGGTTCTCCCTTTGG + Intergenic
993224403 5:85148751-85148773 CCCTCACCTCCTACTCCCTGTGG + Intergenic
997277120 5:132603625-132603647 AACTAAGCAGTTTCTCCCTGAGG - Intronic
998941714 5:147290604-147290626 TACTCATGTCTTTGTCCCTGTGG + Intronic
1000393519 5:160749378-160749400 CCCCCAGCTCCTTCTTCCTGTGG - Intronic
1000450424 5:161379849-161379871 CAGTCAGCCCTTTCACACTGTGG - Intronic
1001551979 5:172609463-172609485 GACACAGCCCTTTCACCCTGGGG + Intergenic
1001948402 5:175798532-175798554 CACACAGCTCTGTCTGCCTGGGG - Intronic
1002400416 5:178988837-178988859 CACCCAGCCCTTCCACCCTGAGG + Intronic
1002447946 5:179301595-179301617 CACACAGCCTTGTCTCCCTGCGG - Intronic
1003518151 6:6834816-6834838 GACTCAGCTCTCTCTCTCTCTGG + Intergenic
1004511472 6:16287427-16287449 CACTCAGCTCAGTCTCCTTTGGG + Intronic
1004636155 6:17469835-17469857 CGCTCAGCACTTTCTCCATAAGG + Intronic
1004891930 6:20109266-20109288 CCCTTAGCTCTTTCTCCTGGGGG - Intronic
1005264967 6:24102110-24102132 CACTCAGTTCTGTCTTGCTGAGG - Intergenic
1007251787 6:40500230-40500252 CACCCAGCTCTGTGTCCCAGGGG + Intronic
1007473984 6:42107152-42107174 GACTCGTCTCTTTCCCCCTGGGG - Exonic
1007680206 6:43628757-43628779 CTCTCCACTCTTCCTCCCTGAGG + Intronic
1009238008 6:61148320-61148342 AACACATCTTTTTCTCCCTGTGG - Intergenic
1009452530 6:63818513-63818535 CACCCTTCTCCTTCTCCCTGAGG + Intronic
1009856440 6:69271222-69271244 CTCTCAGCTCTCTCAACCTGTGG - Intronic
1011920995 6:92577253-92577275 AACTCAGCCATTTCTACCTGTGG + Intergenic
1012953374 6:105542413-105542435 CCCTGAGCTTTTTCTCCCTAAGG - Intergenic
1013816278 6:114102291-114102313 CACATAGTTCTTTCTACCTGAGG + Intronic
1014030434 6:116695532-116695554 CACTAAACTCTGTCTCCCTTAGG - Intronic
1014137435 6:117906599-117906621 TACTCATGTCTTTCTCCCAGGGG - Intergenic
1015371919 6:132463756-132463778 CACTAAACTTTCTCTCCCTGTGG + Intronic
1015897168 6:138028580-138028602 CACTCAGCTCCTTTTCCCATTGG - Intergenic
1016740587 6:147524632-147524654 CACCTACCTCCTTCTCCCTGTGG + Intronic
1018770952 6:166971059-166971081 CACTCAGCTCTTTCCAGCCGAGG + Intergenic
1018856970 6:167681742-167681764 CACTGTGGTCTTCCTCCCTGGGG - Intergenic
1020906504 7:14070185-14070207 CACTCCTCTCTTTCCCGCTGCGG + Intergenic
1021403164 7:20233572-20233594 CACTCATCTTTTTTTCCCAGAGG - Intergenic
1022177380 7:27884885-27884907 CACTCAGCTCTGTGGCCCCGAGG + Intronic
1023253335 7:38289120-38289142 CGCTCAGGTCATTCTCCCTGTGG + Intergenic
1023956943 7:44894122-44894144 CACTCACCTAGTGCTCCCTGGGG + Intergenic
1024556480 7:50607444-50607466 CAGTCAGCTCTTCCCTCCTGAGG - Intronic
1026674134 7:72415227-72415249 TACCTAGATCTTTCTCCCTGTGG + Intronic
1026824471 7:73572847-73572869 CACGCTGCTGTATCTCCCTGTGG - Exonic
1028406852 7:90484836-90484858 CTCTCAGCTCTGCCTCCCTCTGG + Intronic
1031554670 7:123158464-123158486 CATTCTGCACTTTCTCACTGTGG - Intronic
1031591928 7:123604091-123604113 CACTGAGCTTTTTCTTCCAGAGG - Exonic
1034502904 7:151462493-151462515 CACCCAGCACTTTCTCCCTGGGG + Intergenic
1035699436 8:1626896-1626918 CCCTTCGCCCTTTCTCCCTGGGG + Intronic
1036696583 8:10979117-10979139 CAGTGAGCTCTTTCTCATTGGGG - Intronic
1039537420 8:38329856-38329878 CACTGAGCACGTTCTCTCTGAGG + Exonic
1042876602 8:73446148-73446170 CACTCAGCTTCATGTCCCTGAGG - Intronic
1043930084 8:86081028-86081050 CACACAATTCTTTCTCTCTGGGG + Intronic
1045385595 8:101668411-101668433 AGCTCAGCTGTTTCTCCTTGAGG + Exonic
1045823990 8:106375082-106375104 CACTTAGATATTTTTCCCTGAGG + Intronic
1046520879 8:115324117-115324139 AATTCAGCTCTTTCTCTCTTAGG - Intergenic
1046924142 8:119768227-119768249 AACTCAGCTGTTACTGCCTGAGG + Intronic
1048556344 8:135481158-135481180 CACTCCTCTCTTTGACCCTGAGG + Intronic
1048896765 8:138999321-138999343 TACACAGCTCCTTCTGCCTGTGG + Intergenic
1048991080 8:139760505-139760527 CCCTGAGCTCTTTCTCAATGAGG + Intronic
1049104597 8:140603974-140603996 CATGCAGCTCCTTCACCCTGAGG - Intronic
1049106453 8:140616759-140616781 CAGTGAGCTCTCTCCCCCTGAGG - Intronic
1051193292 9:14536591-14536613 AACTCAGTTCATCCTCCCTGTGG - Intergenic
1052142567 9:25004655-25004677 TAATCAGCTCTTTCTGTCTGTGG + Intergenic
1052320801 9:27165361-27165383 CATGCAGCTCTTGCTCTCTGTGG - Intronic
1052684741 9:31740743-31740765 AATTCAGCTTCTTCTCCCTGAGG - Intergenic
1053720004 9:40935874-40935896 CCCTCAGGTCTTCCTGCCTGTGG - Intergenic
1056854760 9:90116788-90116810 CTCTTGCCTCTTTCTCCCTGTGG + Intergenic
1057448726 9:95137734-95137756 CACTCAGAGCTTCCTCCCTTGGG - Intronic
1058143339 9:101381482-101381504 GAGTCAGCTCTTTCACCCAGTGG - Intronic
1059560370 9:115328837-115328859 TACTCAGCTCTATTTCTCTGGGG + Intronic
1059733124 9:117076029-117076051 CACTCAGCTCTGTATCCCCAGGG - Intronic
1060813039 9:126620616-126620638 TGCTGTGCTCTTTCTCCCTGGGG + Intronic
1061488050 9:130930264-130930286 CTCTCTCCACTTTCTCCCTGAGG - Intronic
1061623001 9:131823922-131823944 CAGACAGCTCTTTCTGCGTGGGG + Intergenic
1062473915 9:136718381-136718403 GACTTAGCCCTATCTCCCTGAGG - Intronic
1062683521 9:137798050-137798072 CTTTCAGCTCTGTTTCCCTGAGG - Intronic
1203455003 Un_GL000219v1:158697-158719 CCCTCAGGTCTTCCTGCCTGTGG + Intergenic
1186744657 X:12555009-12555031 CACTCTGCTTCATCTCCCTGTGG + Intronic
1187465520 X:19523806-19523828 CATTCAGGTCTTTCACCCTAAGG + Intergenic
1190497517 X:51040811-51040833 CCCTCTGCCCTTTCTCCCTCTGG - Intergenic
1190909246 X:54757061-54757083 CAGTCTGCTCCTTCTCCCTGAGG - Exonic
1191590169 X:62874066-62874088 GACTGAGCTCTTTCTACCTGAGG + Intergenic
1191612061 X:63127550-63127572 CACTTTGCTGTTTCTCCCTCAGG - Intergenic
1192351832 X:70362293-70362315 AACTCAGCTCTTTCTCCGTGGGG + Intronic
1194248916 X:91549037-91549059 CAGTGTGCTTTTTCTCCCTGTGG - Intergenic
1194738783 X:97547147-97547169 CCTTCAGCTCTTTCTGACTGGGG - Intronic
1195706437 X:107741172-107741194 CACTGGCATCTTTCTCCCTGGGG + Intronic
1195744976 X:108107941-108107963 CACACATCCCCTTCTCCCTGAGG - Intronic
1195879897 X:109581636-109581658 AACTGCGGTCTTTCTCCCTGAGG - Intergenic
1197657595 X:129133933-129133955 CAGTCAGTACTTTCTCCCTTGGG - Intergenic
1197919429 X:131576060-131576082 CACTAGGCTCTGTCTCCCTATGG - Intergenic
1198272140 X:135065063-135065085 CAATAAACTCTTTCTCCCTGAGG + Intergenic
1199480031 X:148288312-148288334 CACTCAGATCTCTATCTCTGTGG + Intergenic
1200567926 Y:4790572-4790594 CAGTGTGCTTTTTCTCCCTGTGG - Intergenic
1200871933 Y:8111128-8111150 AACAAAACTCTTTCTCCCTGAGG + Intergenic
1200888518 Y:8297348-8297370 AACAAAACTCTTTCTCCCTGAGG - Intergenic
1201250274 Y:12050498-12050520 CCCTCAAATCTGTCTCCCTGTGG - Intergenic
1201738972 Y:17303572-17303594 CACACTGCTCTTTCTTCTTGTGG - Intergenic
1202100753 Y:21305200-21305222 AACAAAACTCTTTCTCCCTGGGG + Intergenic
1202244037 Y:22797926-22797948 AACAAAACTCTTTCTCCCTGAGG - Intergenic
1202397025 Y:24431676-24431698 AACAAAACTCTTTCTCCCTGAGG - Intergenic
1202473758 Y:25238416-25238438 AACAAAACTCTTTCTCCCTGAGG + Intergenic