ID: 1138249742

View in Genome Browser
Species Human (GRCh38)
Location 16:55492783-55492805
Sequence CAGGGCGGTCAGGGGGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 310}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138249742_1138249753 9 Left 1138249742 16:55492783-55492805 CCAGCGGCCCCCTGACCGCCCTG 0: 1
1: 0
2: 1
3: 31
4: 310
Right 1138249753 16:55492815-55492837 GGCATAAGAATCTGAGCTTTGGG 0: 1
1: 0
2: 0
3: 23
4: 243
1138249742_1138249754 22 Left 1138249742 16:55492783-55492805 CCAGCGGCCCCCTGACCGCCCTG 0: 1
1: 0
2: 1
3: 31
4: 310
Right 1138249754 16:55492828-55492850 GAGCTTTGGGTTTGAATCCTTGG 0: 1
1: 0
2: 2
3: 26
4: 225
1138249742_1138249752 8 Left 1138249742 16:55492783-55492805 CCAGCGGCCCCCTGACCGCCCTG 0: 1
1: 0
2: 1
3: 31
4: 310
Right 1138249752 16:55492814-55492836 GGGCATAAGAATCTGAGCTTTGG 0: 1
1: 0
2: 1
3: 11
4: 139
1138249742_1138249755 23 Left 1138249742 16:55492783-55492805 CCAGCGGCCCCCTGACCGCCCTG 0: 1
1: 0
2: 1
3: 31
4: 310
Right 1138249755 16:55492829-55492851 AGCTTTGGGTTTGAATCCTTGGG 0: 1
1: 0
2: 0
3: 17
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138249742 Original CRISPR CAGGGCGGTCAGGGGGCCGC TGG (reversed) Intronic
900105796 1:980510-980532 CAGGGCTATCGGGGGGCCTCTGG + Exonic
900140326 1:1137053-1137075 CAGGGCGGGGAGGGCGCGGCCGG + Intergenic
900415840 1:2534377-2534399 CTGGGCGGGGAGGGGGCAGCAGG - Intergenic
900464452 1:2818289-2818311 CAGGGCTGGCTGGGGGCCCCAGG + Intergenic
900479677 1:2891944-2891966 CTGGGCAGTCAGAGGGCCCCGGG + Intergenic
900831616 1:4969671-4969693 CAGGGAGGTCATGGGGAGGCTGG + Intergenic
901059579 1:6465865-6465887 CAGGAGGGTCTGGGGGCCCCAGG - Intronic
902515974 1:16989855-16989877 CAGGGCGGCCAGGGAGCTGGGGG + Intronic
903044178 1:20553359-20553381 CCGGGGGTTCGGGGGGCCGCAGG + Exonic
903134028 1:21297435-21297457 CAAGGGGGTCAGGGGGTCACCGG - Intronic
903189512 1:21648960-21648982 CAGGGCTGTCTGGGGTCCGTGGG - Intronic
903268580 1:22173786-22173808 CAGGCTGGCCAGGTGGCCGCTGG + Intergenic
903724661 1:25431379-25431401 CCGGGCGGGCAGGGCGCGGCGGG + Intronic
904034634 1:27552008-27552030 CCGGGGGGTGGGGGGGCCGCCGG + Exonic
904199967 1:28813051-28813073 CAGGGCGGACAGGAGGGTGCTGG + Intronic
904537175 1:31207575-31207597 CAGGGGGGTCAGGCAGCTGCTGG - Intronic
908252279 1:62274539-62274561 CAGGAGGGGCAGGGGGCCCCAGG + Exonic
909329651 1:74396167-74396189 CAGGGAGATCAGAGGGCAGCAGG + Intronic
910586989 1:88891300-88891322 CAGGACTGTCAGGGTGTCGCAGG - Intronic
911208733 1:95117904-95117926 CCGGGCGGCGCGGGGGCCGCGGG - Exonic
915447897 1:155984559-155984581 GAGGGCGGGCAGTGGGCAGCAGG + Intronic
917929878 1:179815776-179815798 GAGGAAGGTCAGGGTGCCGCTGG + Exonic
920071368 1:203305459-203305481 CAGGGAGGTAGGGGGGCAGCCGG - Intergenic
920184424 1:204151534-204151556 CAGGGCTGCCAGGGGGATGCGGG - Intronic
922223482 1:223626430-223626452 CAGGGCAGCCAGAGGGCAGCTGG + Intronic
922550098 1:226488435-226488457 CAGGGCTTCCAGGGGGCAGCAGG - Intergenic
923126723 1:231040151-231040173 CGGCGCGGTCCGGGGGCTGCGGG - Exonic
923525274 1:234767804-234767826 AAGGGAGGTCAGGGGGCCCTTGG - Intergenic
1063588310 10:7372880-7372902 TAGGGCAGGCAGGGGGCTGCAGG - Intronic
1063665623 10:8058665-8058687 CAGGGCGGTCATGCTGCCACGGG - Exonic
1064292724 10:14050641-14050663 CAGGGAGGGCAGGGGGCCTACGG + Intronic
1064605723 10:17036593-17036615 CAGGGCTGCCAGGGGGCTGAAGG + Intronic
1066460536 10:35608551-35608573 CAGGCGGGTCAGGGGGCTGCAGG - Exonic
1070360735 10:75686156-75686178 CAGGGAGGACAGAGGGCCACTGG + Intronic
1070733978 10:78851165-78851187 CAGGGCTGGCTGGGGGCCGCAGG - Intergenic
1071208599 10:83312732-83312754 CAGGGCTGGCAGGGGGCCACTGG - Intergenic
1071598642 10:86945338-86945360 CAAGGGGGGAAGGGGGCCGCAGG + Intronic
1073262817 10:102203463-102203485 CAGGGAGATCAAGGGGCAGCAGG - Intergenic
1073290074 10:102409139-102409161 CCGGGCGGCCCGGGGGCCGAGGG - Intronic
1073429410 10:103476566-103476588 GAGGGGGGTCAAGGGGCAGCTGG + Intronic
1073471835 10:103727403-103727425 CAGGGAGGACAGGGGGCCCCAGG + Intronic
1074977977 10:118596219-118596241 CAGCGCGCTCAGCGGGCAGCGGG + Intergenic
1075048788 10:119166401-119166423 TAGGTCGTTCAGGGGGCCTCCGG + Intergenic
1075940666 10:126388092-126388114 CAGGGCGAGCAGGAGGGCGCGGG + Exonic
1076577109 10:131476542-131476564 CCTGGCTGCCAGGGGGCCGCAGG - Intergenic
1076775248 10:132692035-132692057 CAGCGCAGTCGGGGGGCCTCGGG + Intronic
1076792592 10:132785182-132785204 CGGGGCGGTCAGGCGGCCGCGGG + Intronic
1076809312 10:132878481-132878503 CAGGGCCGCGAGGGGCCCGCAGG - Intronic
1077051704 11:569511-569533 CAGGGAGGTCATGGGGCCAGGGG - Intergenic
1077190675 11:1254874-1254896 CAGTGCGGTGAGTGGGCGGCGGG + Exonic
1077231606 11:1460287-1460309 CAGGGTGGGCAGGCGGCGGCCGG - Intronic
1077392305 11:2305651-2305673 CAAGGCGGTCAGGGAGCACCTGG + Intronic
1079129405 11:17738571-17738593 CAGGGCAGGCAGGGGGCAGTGGG + Intronic
1081439722 11:43066555-43066577 CAGGCAGTTCAGGGGGCCACAGG + Intergenic
1083262070 11:61528534-61528556 CAGGGAGGTCTGGGGGGCTCAGG - Intronic
1083263690 11:61536491-61536513 CAGGGCAGTCAGAGGGCCACTGG - Intronic
1083275512 11:61594903-61594925 CAGTGGGGTCAGGGAGCCCCGGG - Intergenic
1083384158 11:62295402-62295424 TGGGGAGGTCAGGGGGCAGCAGG - Intergenic
1083592768 11:63904982-63905004 CAGGGCCGGCGGGGGGCCTCTGG + Exonic
1083593765 11:63909599-63909621 CAGGGAGGAAAGGTGGCCGCTGG - Exonic
1083683440 11:64361765-64361787 GAGGGCGGCCAGAGGGCTGCAGG + Intronic
1083888696 11:65585202-65585224 CTGCGCGGTCACGGGGCCGAGGG + Exonic
1084430006 11:69105840-69105862 CGGGGCGGGGAGGGGGCCTCCGG - Intergenic
1088814110 11:113409983-113410005 CAGGGCCGTCAGAAGGCAGCAGG + Exonic
1089605542 11:119639130-119639152 CAGGGCGGGCATGAGGCCTCAGG + Intronic
1089913182 11:122124443-122124465 CAGGGCGGTGGGGGGGCAGGGGG - Intergenic
1092111230 12:5966144-5966166 CAGGGCAGTCAGGAGACAGCAGG - Intronic
1094844902 12:34357200-34357222 CAGGGACGTCCGGGGTCCGCTGG + Intergenic
1101005734 12:100399257-100399279 CAGGGCAGTCTGGGAGCAGCTGG + Intronic
1101466900 12:104958307-104958329 GCGGGGAGTCAGGGGGCCGCGGG - Intronic
1102068652 12:109999605-109999627 CAGGGCAGGCAGGCGGGCGCGGG + Exonic
1102262630 12:111453747-111453769 GAGGGCGGCCTGGGGACCGCCGG + Exonic
1102452193 12:113050191-113050213 CAGGGAGGTCAGTGGGCTGGAGG - Intergenic
1102466993 12:113135756-113135778 CTGGGCGGGCAGGGGGCGGGAGG + Intronic
1102534534 12:113570653-113570675 CAGGGTGGGCAGGGGGGCGGGGG + Intergenic
1103985113 12:124761736-124761758 CAGTGAGGTCATGAGGCCGCTGG - Intergenic
1104941882 12:132399121-132399143 CTGGTCTGTCAGGGGGCAGCAGG + Intergenic
1105726194 13:23164773-23164795 CAGGGCTGGCAGGAGGCCGGAGG - Intergenic
1113520127 13:110934631-110934653 CAGGGAGATCAGGGGACAGCAGG + Intergenic
1113537860 13:111082377-111082399 CAGGGCAGCCAGGAGGACGCTGG - Intergenic
1114280294 14:21187973-21187995 CAGGCCGGTCAAAGGGACGCCGG + Intergenic
1114483227 14:23047972-23047994 CCGGGCGCTCAGGGGGCCGGGGG + Exonic
1114524504 14:23359548-23359570 CAGGGCAGGCAGAGGGCGGCGGG + Exonic
1115728138 14:36239302-36239324 CGGGGCGGTGGGGGGGGCGCGGG + Intergenic
1117029065 14:51651312-51651334 GCGGGCGGGCAGGGGGCTGCAGG + Intronic
1119538064 14:75419232-75419254 GAGGGCGGTCAGAAGGCCTCTGG - Intergenic
1120645468 14:87069244-87069266 CTGGGTGGTCAGAGGGCCCCGGG - Intergenic
1122162232 14:99793147-99793169 CCGGGCGGCCTGGGAGCCGCAGG - Intronic
1122541371 14:102499505-102499527 CAGGGCGGTCACGGGACCTGCGG + Exonic
1122971914 14:105155722-105155744 AAGGAAGGTGAGGGGGCCGCTGG - Exonic
1123030533 14:105449238-105449260 CAGGGCAGAACGGGGGCCGCAGG - Intronic
1124453650 15:29821855-29821877 CAGGGCTGGCGCGGGGCCGCGGG - Intronic
1127992886 15:64133762-64133784 CAGGGCAGTGAGGGAGCCGCTGG + Intronic
1128346917 15:66859860-66859882 CAGGGTGGTCACTGGGCAGCAGG - Intergenic
1128865989 15:71115562-71115584 CAGGGCGGGCGCGGGGCGGCTGG + Intronic
1129162245 15:73753228-73753250 CGGGGCGGGCCGGGGGCGGCCGG - Intergenic
1130923398 15:88367384-88367406 CAGGGAGTTCTGGGGGACGCAGG - Intergenic
1132513038 16:353368-353390 GAGGGCAGTCAGGGGGCTGCAGG + Intergenic
1132670283 16:1099713-1099735 CTGGGCGGTCCCGGGGCTGCAGG + Intergenic
1132717844 16:1301063-1301085 CAGGGCCAGCAGGGGGCGGCAGG + Intergenic
1132865638 16:2091486-2091508 GAGGGCGGCCAGGGCGCGGCCGG + Exonic
1132891328 16:2206227-2206249 CGGGGCGGGCAGGGCGGCGCTGG + Intronic
1132894664 16:2223152-2223174 CTAGGCGGTCAGTGGGCAGCAGG + Intergenic
1133034778 16:3028578-3028600 CAAGGAGGTCAGGGGGCCCCTGG + Intronic
1133739901 16:8643519-8643541 CAGTGAGGGCAGGGGGCCCCGGG + Intronic
1136220480 16:28824458-28824480 GAGGGCGAAGAGGGGGCCGCTGG - Intronic
1136391081 16:29964659-29964681 CAGGGTGGTGGGGGGGGCGCGGG - Intronic
1136544910 16:30949293-30949315 AAGGGCGGCGAGGGGGACGCGGG + Exonic
1137557668 16:49482957-49482979 CAGGGTGGCCAGGGGGCACCTGG + Intergenic
1138125861 16:54437806-54437828 CAGAGCTGTCAGGGGTCTGCTGG + Intergenic
1138249742 16:55492783-55492805 CAGGGCGGTCAGGGGGCCGCTGG - Intronic
1138512402 16:57516229-57516251 CAGGGAGGAGTGGGGGCCGCAGG - Intronic
1139476087 16:67203253-67203275 CAGGGCGGTCTGGGGAGAGCAGG - Intronic
1139826639 16:69762437-69762459 CGGGGCGGGCCGGGGGCGGCGGG + Intronic
1139950330 16:70665187-70665209 CAGGGCTATCAGGGGGTCTCTGG + Intronic
1139952477 16:70679058-70679080 CAGGGCGGGATGGGGGCCACAGG - Intronic
1141203644 16:81915781-81915803 CAGGGCAGGCAGGGGGGCTCTGG - Intronic
1141233958 16:82198028-82198050 CAGGGAGGTCAGCGGGACGGTGG + Intergenic
1141506435 16:84481462-84481484 AAGGGCGGTCTGGTGGCGGCAGG - Intronic
1141689115 16:85586636-85586658 CACGGCAGTCGGGGGGGCGCGGG - Intergenic
1141940596 16:87273539-87273561 CAGGGAGGTCGGGGGGCAGGGGG + Intronic
1141945333 16:87305499-87305521 CAGGGCAGCCTGGGGGCGGCGGG - Intronic
1142078065 16:88131893-88131915 CAGAGCGGGCAGGTGGGCGCGGG - Intergenic
1142178867 16:88657615-88657637 CAGGGCGGGCAGGGTGCTGACGG - Intronic
1142284949 16:89167875-89167897 CAGAGGGGTCAGGGGGTGGCGGG - Intergenic
1142348344 16:89568444-89568466 CTGGGCAGACAGGCGGCCGCAGG + Intergenic
1142359231 16:89618988-89619010 CGGGGGGGGCAGGGGGCTGCAGG - Intronic
1142359259 16:89619049-89619071 CAGGGGGGGCAGGGGGCTGCAGG - Intronic
1142359286 16:89619110-89619132 CAGGGGGGGCAGGGAGCTGCAGG - Intronic
1142359396 16:89619352-89619374 CAGGGGGGGCAGGGGGCTGCAGG - Intronic
1142359411 16:89619383-89619405 CAGGGGGGGCAGGGGGCTGCAGG - Intronic
1142359495 16:89619573-89619595 CAGGGGGACCAGGGGGCTGCAGG - Intronic
1142605447 17:1078714-1078736 CGGGGAGGTTAGAGGGCCGCAGG - Intronic
1143151033 17:4807647-4807669 GCGGGCGGTCAGGAGGCCGTGGG + Intronic
1143389004 17:6549196-6549218 CAGGGCTGGCAAGGGGCTGCGGG - Intronic
1143980109 17:10861582-10861604 CAAGGCGATCAGGAGGCAGCGGG - Intergenic
1148210653 17:45806586-45806608 CATGGTGGTCAGCGGGCCGGTGG + Intronic
1149701826 17:58661703-58661725 CAGGGCAGTCAGGGAGGCGGTGG + Intronic
1149850032 17:60028681-60028703 CAGGGTGCTCAGGGGCCTGCCGG + Intergenic
1149860135 17:60117843-60117865 CAGGGTGCTCAGGGGCCTGCCGG - Intergenic
1150083605 17:62262481-62262503 CAGGGGGCTCAGAGGGCTGCTGG + Intergenic
1150770266 17:68035456-68035478 CCGGGCGGTGAGGGAGCGGCCGG - Intergenic
1150770273 17:68035475-68035497 CCGGGCGGTGAGGGAGCGGCCGG - Intergenic
1150770280 17:68035494-68035516 CCGGGCGGTGAGGGAGCGGCCGG - Intergenic
1150770287 17:68035513-68035535 CCGGGCGGTGAGGGAGCGGCCGG - Intronic
1151309719 17:73285761-73285783 CATGGCGATGAGGGCGCCGCTGG - Exonic
1151483310 17:74383206-74383228 CAGGGAGGCCAGGGAGCAGCTGG + Intergenic
1152135415 17:78500491-78500513 CAGGGAGGCCATGGGGTCGCTGG - Intronic
1152333520 17:79686751-79686773 CAGGGAGGTCAGGAAGCCACAGG + Intergenic
1152571905 17:81124625-81124647 TAGTGAGGTCAGGGGGCTGCCGG - Intronic
1152687896 17:81703607-81703629 CAGGCGGGTTAGGGGGCAGCCGG + Intronic
1153265161 18:3262335-3262357 CAGGGCGGCCAGGCGGCGGCAGG + Intronic
1154161125 18:11981491-11981513 AAGGGCAGCCAGCGGGCCGCGGG - Exonic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1156448289 18:37252865-37252887 AGGGGCGGTCAGAGGGCAGCAGG + Intronic
1157100621 18:44725719-44725741 CTGGGAAGTCAGGGGGCCGAGGG - Intronic
1158318119 18:56234838-56234860 GAGGGCGGGCAGGGGGCCGGGGG - Intergenic
1158349793 18:56553244-56553266 CAGGTCAGTCACGGGGCTGCAGG + Intergenic
1160239775 18:77114853-77114875 CAGGGCGAGCAGTGGGCTGCAGG + Intronic
1160537495 18:79602936-79602958 CAGGACTGTCAGGGGGCTTCCGG + Intergenic
1160557903 18:79738017-79738039 CAGGGCGGGCGGGGGGAGGCGGG - Intronic
1160690975 19:460653-460675 CGGGGCGGGCGGGGGGCGGCGGG - Exonic
1160818259 19:1046250-1046272 CAGGTCGGTCAGGGGGTCCGCGG - Exonic
1160863736 19:1248504-1248526 TAGGGCGGGCAGGGGGGCGGGGG - Intergenic
1161108217 19:2455117-2455139 CAGGGTGGGTAGGGGGCCGAGGG - Intronic
1161397580 19:4052614-4052636 CAGGGCGGGCGGGGGGCAGGGGG + Intronic
1161707463 19:5828930-5828952 CAGTGCGGACAGGGAGACGCTGG - Intergenic
1162054129 19:8052693-8052715 GAGGGCGGGCAGGGGGTGGCTGG + Intronic
1162142959 19:8595712-8595734 CTGGGAGGGGAGGGGGCCGCTGG - Intronic
1162369669 19:10271167-10271189 CAGCGCGGGCCGGGGGCTGCTGG - Exonic
1162398336 19:10430733-10430755 CAGGGCGGGGTGGGGCCCGCGGG + Intronic
1162760790 19:12887090-12887112 CAGGGCGGTCAGTGTGCTGATGG + Exonic
1162791800 19:13066864-13066886 CAGGGCAGCCAGAGGGCCGGGGG - Intronic
1163304785 19:16471495-16471517 CCGGGCGGGCAGGGTCCCGCCGG - Intronic
1163633282 19:18427618-18427640 CAGGGTGGGCAGAGGGCCCCAGG - Intronic
1164158726 19:22612481-22612503 CAGGCTGGTCAGAGGGCTGCAGG - Intergenic
1165821008 19:38676049-38676071 CAGGGCTGTCAGGATGCAGCGGG + Intronic
1166178308 19:41090001-41090023 GAGAGAGGTCAGGGGGCGGCGGG - Intronic
1166326519 19:42054225-42054247 CAGGGAGGGCAGAGGGCCACAGG + Intronic
1166799038 19:45444481-45444503 CTGGGCGGTCAGGAGGCCACCGG + Intronic
1167071724 19:47226121-47226143 CGGGGCGGGCCGGGGACCGCAGG - Intronic
1167455394 19:49595001-49595023 CAGGGCGGTAAGGGGGGGTCTGG - Exonic
1167502274 19:49854956-49854978 CAGGGTGGTCTGGGGGCGACAGG - Exonic
1167645322 19:50702600-50702622 CGGGGGGCTCAGGGGGCCCCGGG - Exonic
1167645811 19:50704207-50704229 CAGGTCGGCCAGGGGGGCCCAGG + Intronic
1168118837 19:54240838-54240860 CAGGATGTTCAGGGGGTCGCTGG + Exonic
1168307357 19:55442756-55442778 CAGGGCGGGCAGCGGGCCCGCGG + Exonic
925033612 2:670764-670786 CAGAGCTGGCAGGAGGCCGCAGG + Intronic
926396973 2:12453481-12453503 TAGGGCTGTCTGGGGGCAGCTGG + Intergenic
926936118 2:18087959-18087981 CAGGGAGATCAGGGGGCAACAGG - Intronic
927818914 2:26245073-26245095 CAGGGAGGGGAGGGGGCCGGGGG - Intronic
927937175 2:27082593-27082615 CAGGGCTGGCGGTGGGCCGCAGG + Exonic
927945731 2:27134211-27134233 CAGGGTGGCCGGGGGGTCGCGGG - Intronic
927985651 2:27409045-27409067 GAGGGCGGTCAGTGGGCGGAAGG + Intronic
928414396 2:31079588-31079610 CAGGGAGGTCTGGTGGCAGCAGG - Intronic
934753484 2:96809526-96809548 CAGGGTGGGCAGGGGGCCCCGGG - Exonic
934896255 2:98122707-98122729 CAGTCAGGTCAGGGGGCCACAGG - Intronic
935211251 2:100940923-100940945 CAGGGTAGTCAGGGGGCAGGAGG + Intronic
935645477 2:105330175-105330197 CCGCGTGGTCAGGCGGCCGCGGG - Intergenic
936155285 2:110042971-110042993 CAGGGCTGGGAGGGGGCCCCTGG - Intergenic
936189395 2:110328442-110328464 CAGGGCTGGGAGGGGGCCCCTGG + Intergenic
936267634 2:111022690-111022712 CTGGGAGGTCTGGGGGCCCCTGG - Intronic
938073970 2:128322359-128322381 CTGGGCGGCAAAGGGGCCGCGGG - Intergenic
940667852 2:156630976-156630998 CAGGGCAGTCAGGAGGCAGACGG + Intergenic
941095980 2:161239362-161239384 CAGGGCGGGTTGGGGGCGGCTGG - Intergenic
942965878 2:181891960-181891982 CCGGCCGGGCAGGGGGCCCCGGG - Exonic
947669342 2:231926502-231926524 GAGGGCCGGGAGGGGGCCGCGGG + Intergenic
948725381 2:239930813-239930835 GAGGGAGGTCAGGAGGCCGCAGG + Intronic
948725413 2:239930899-239930921 GAGGGAGGTCAGGAGGCCGCAGG + Intronic
948725447 2:239930985-239931007 GAGGGAGGTCAGGGGGCAGTAGG + Intronic
948843705 2:240672867-240672889 CTGGGCGCGCTGGGGGCCGCTGG + Intergenic
1171034646 20:21705557-21705579 CAGGGCGGGGAGGGGGGCGCTGG + Intergenic
1173349370 20:42231104-42231126 CAGGCTGGTAAGGAGGCCGCTGG - Intronic
1173617908 20:44414704-44414726 CGGGGCAGCCAGGGGGCTGCTGG + Intronic
1175404102 20:58716002-58716024 TGGGGAGGACAGGGGGCCGCTGG + Intronic
1175429486 20:58891568-58891590 CGGGGCGGACTGCGGGCCGCGGG - Intronic
1175609674 20:60340215-60340237 CAGGGTGGTCAGGTGGTCACCGG - Intergenic
1175788076 20:61724230-61724252 CAGGGCAGTGAGGAGCCCGCTGG - Intronic
1178687751 21:34724456-34724478 CAGGCAGGTCTGGGGGCCACTGG - Intergenic
1179609304 21:42539568-42539590 CAGGGCGGTGAAGGCTCCGCTGG - Exonic
1179882231 21:44297704-44297726 CAGGAGGGGAAGGGGGCCGCCGG - Exonic
1180086608 21:45510497-45510519 GCGGGGGGTCAGGGGGCCACGGG - Intronic
1180260892 21:46667970-46667992 CTGGGCCGACAGGGGACCGCGGG + Intergenic
1180797274 22:18611971-18611993 CAGGGCTGTTAGGGGGCTGAAGG - Intergenic
1180960521 22:19760554-19760576 CCGGGCGGTCGGGGGGCCCCGGG + Intronic
1180979123 22:19870451-19870473 AAGGGTGGTCAGGGTGCGGCAGG + Intergenic
1181224449 22:21383300-21383322 CAGGGCTGTTAGGGGGCTGAAGG + Intergenic
1181254183 22:21551513-21551535 CAGGGCTGTTAGGGGGCTGAAGG - Intronic
1181796132 22:25312370-25312392 CAAGGAGGCCAGGGGGCTGCAGG + Intergenic
1181836678 22:25615980-25616002 CAAGGAGGCCAGGGGGCTGCAGG + Intronic
1182321334 22:29480093-29480115 CCGGTCGGCCGGGGGGCCGCAGG + Intergenic
1183154891 22:36067081-36067103 CTGGGCGGTGAGGAGGCGGCTGG + Intergenic
1183673039 22:39283928-39283950 CCCGCCGGGCAGGGGGCCGCGGG - Intergenic
1183683850 22:39350448-39350470 CAGGGCGGACTGGGGACCGTGGG + Intronic
1184037674 22:41926352-41926374 GAGGGAGGCCAGGGGGCCGAGGG + Intronic
1184258759 22:43302482-43302504 CAGGCAGGGCAGGGGGCGGCTGG + Intronic
1184439130 22:44498012-44498034 CCGGCCGGGCAGGGGGCCGGGGG + Intronic
1185080199 22:48705443-48705465 CTGGGAGGTCAGGGGCCCTCTGG - Intronic
1185223676 22:49641386-49641408 CAGGGCCCTCTGGGGGCCCCAGG - Intronic
1185369526 22:50454622-50454644 CTGGGGGTTCAGGGGGCCCCTGG + Exonic
950649111 3:14396298-14396320 CAGGGCAGGCAGGAGGCAGCCGG + Intergenic
953405593 3:42658218-42658240 AAGGGCGGGCAGGGGCCCACTGG + Intronic
960995057 3:123335247-123335269 CAGGGCAGTCAGGAGGCCGAGGG - Intronic
961333617 3:126157306-126157328 CGGGGCGGGCAGGGCGCGGCCGG + Intronic
961827587 3:129606891-129606913 CAGGGCGGCCAGGGGCAGGCGGG - Intergenic
962626179 3:137227970-137227992 CAGGGCAGTGAGGGGGCTCCAGG + Intergenic
962793963 3:138834957-138834979 CAGGGCGGGGCGGGGGCTGCTGG - Intergenic
964730174 3:159856641-159856663 CAGGGCGGTGAGTGGGCCCAGGG + Intronic
967214913 3:187201568-187201590 CAGTGGGGTCAGGGGGCAGAAGG - Intergenic
968126442 3:196163867-196163889 CAGGCCGGCCCGGGGGCTGCAGG - Intergenic
968520823 4:1033973-1033995 CGGGGCGGTCAGGGTGGCGCCGG + Intergenic
968618432 4:1592786-1592808 CAGGGAGGAGAGGCGGCCGCGGG + Intergenic
968922537 4:3530150-3530172 CAGGGTGGTCAGGAGGCAGGAGG - Intronic
969613931 4:8241575-8241597 CAGGGCGGTGAGGGTGGCCCAGG + Intronic
973732288 4:53834022-53834044 CATGGAGGTCAGGGGCCCACTGG - Intronic
974878246 4:67723127-67723149 CAAGGTGGTCAGGGAGCAGCTGG - Intergenic
983931671 4:173460046-173460068 CAGGGCGGTGGCGGGGCAGCGGG - Intergenic
984944522 4:184960732-184960754 CAGGGCGTGCAGGGGGCCCCAGG + Intergenic
985247872 4:187995495-187995517 CGCGGGGGTCAGGGGGCCCCGGG + Intergenic
985701778 5:1377956-1377978 CAGAGCGCTCAGAGGGCAGCGGG - Intergenic
985748936 5:1663557-1663579 CTGGGAGGTCAGGGGGTGGCTGG + Intergenic
990545165 5:56815359-56815381 GAGGGCGGCCCGGCGGCCGCAGG - Intergenic
991435821 5:66596493-66596515 CATGGCAGTGACGGGGCCGCAGG - Exonic
996785167 5:127229763-127229785 CTGGGCCGCCAGGGGCCCGCAGG + Intergenic
998250280 5:140547846-140547868 CGGGCCGGGCAGGGGTCCGCAGG + Intronic
999314147 5:150573490-150573512 CAGGGGGGTCAGGGAGACCCTGG + Intergenic
1001098153 5:168792203-168792225 CATGGAGGTCAGTGGGCAGCTGG - Intronic
1001966664 5:175914483-175914505 GCGGGCGGTGAGGGGGCAGCAGG - Intergenic
1002065014 5:176647546-176647568 CAGGGCGGCCCGCGGGGCGCTGG + Exonic
1002250283 5:177924721-177924743 GCGGGCGGTGAGGGGGCAGCAGG + Intergenic
1002590983 5:180291734-180291756 CGGGGCGGGCCGGGGGCTGCGGG - Intronic
1002635041 5:180603125-180603147 CAGGGCGGGCAGAGGGCTGGAGG - Exonic
1002814741 6:669270-669292 CAGGGCTGGCAGGGGGCCACAGG - Intronic
1002854402 6:1024329-1024351 CAGGCCTGGCAGGAGGCCGCTGG + Intergenic
1004208290 6:13613084-13613106 CAGGGTGGTCCAGTGGCCGCGGG + Exonic
1005797409 6:29380239-29380261 CAGGGCAGTCAGGTGGCATCTGG + Intronic
1006049228 6:31328220-31328242 CAGAGTGGTCAGGGGCCCACTGG + Intronic
1006131261 6:31870762-31870784 CAGGGCGGTCCTTGGGCAGCTGG + Intronic
1006502707 6:34468538-34468560 CAGGGCAGCCAGGGGGCAGAGGG - Intronic
1007072838 6:39049183-39049205 CAGGGCGGCCGCGGGGCAGCGGG - Intronic
1008598744 6:53068087-53068109 CAGGGCGGCCAGGGGGGGGAGGG - Intronic
1012128999 6:95467212-95467234 CAGGGTGGTCAGGAGACCCCAGG - Intergenic
1013225763 6:108118532-108118554 CAGGGGGCGCAGGGGGCGGCCGG + Intronic
1013426580 6:110017997-110018019 CAGGGCGGTCCCGGGGCTGCGGG + Intergenic
1015965385 6:138692393-138692415 CAGGGCCGCCAGGGGGCGGGCGG + Intronic
1017559895 6:155615680-155615702 CAGGGCGGTCTCAGGGCCCCAGG - Intergenic
1019310179 7:356736-356758 CAGAGCGGTCAGGGGTGGGCTGG - Intergenic
1019339195 7:500515-500537 CAGGGCGGTGAGTGGGCCGAGGG + Intronic
1019384453 7:746677-746699 CAGGGTGGGCAGGGGGTGGCAGG - Intronic
1019485520 7:1287593-1287615 CAGGGAGGTCGGGGGCCCCCAGG - Intergenic
1019648790 7:2145088-2145110 CAGGGCTCTCAGTGGGCAGCGGG - Intronic
1019795247 7:3043806-3043828 CAGGGCCGGGAGGGGGCTGCGGG + Exonic
1019925927 7:4191745-4191767 CAGGGTGGACAGGGGGCTGCAGG + Intronic
1021231023 7:18086650-18086672 CAGGGCGGGCCGGGAGGCGCGGG - Intergenic
1022741802 7:33129267-33129289 GAGGGCGGTCACGCGGCCGGGGG + Intronic
1022989582 7:35694774-35694796 CAGGGCGGTCAGCGGGCACTGGG + Exonic
1024654036 7:51434185-51434207 CAGGGAGGTCATGGGGCCAATGG - Intergenic
1026010039 7:66629213-66629235 CCGGGCGGGCGGCGGGCCGCGGG + Intronic
1029557245 7:101278914-101278936 GGGGGCTGTCAGGGGGCCTCAGG + Intergenic
1029746476 7:102517928-102517950 CAGGGCGGGGAGGGGCCGGCCGG + Intergenic
1029764413 7:102616907-102616929 CAGGGCGGGGAGGGGCCGGCCGG + Intronic
1032085280 7:128880483-128880505 CAGGGCCGTGAGGTGGCCTCTGG - Exonic
1034488665 7:151381524-151381546 CGGGGCGCTCTGGGAGCCGCTGG + Exonic
1034508923 7:151519219-151519241 CCGGGCGGGCAGGTGGCGGCCGG - Intronic
1034569067 7:151940739-151940761 CAGGGCGGAGTGGGGGGCGCTGG + Intergenic
1035626989 8:1077902-1077924 CAGGGCTGTGCGGCGGCCGCTGG - Intergenic
1037706010 8:21315856-21315878 AAGGGCGGGCAGGAGGCAGCAGG - Intergenic
1039467796 8:37796723-37796745 CAGGGCGGGCGCGGGGACGCAGG + Intronic
1040304494 8:46205028-46205050 CAGGGTTGTAAGGGGGCCTCGGG + Intergenic
1041022075 8:53648209-53648231 CAGGGCAGTTAGGGGGTGGCAGG - Intergenic
1042216371 8:66432591-66432613 GCGGGCGGGCAGGGGACCGCAGG + Intronic
1044430707 8:92103320-92103342 CAGGGCGGCCGGGCGTCCGCCGG + Intergenic
1045252731 8:100495056-100495078 CAGCACGGTCAGGGAGCCGAGGG - Intergenic
1048985337 8:139731941-139731963 CAAGGCGGTCTGGGAGCCTCTGG - Intronic
1049261628 8:141642076-141642098 CAGGGCAAGAAGGGGGCCGCAGG + Intergenic
1049293670 8:141818059-141818081 CAGGTCGGTCAGGGGAGCTCTGG + Intergenic
1049332107 8:142060082-142060104 CTGGGAGGTCAGGAGGCCGCGGG - Intergenic
1049402275 8:142433774-142433796 CAGGGCTGTGAAGGGGCCGCTGG - Intergenic
1049688471 8:143948718-143948740 CAGGGCGGGCAGCTGGCGGCAGG - Intronic
1049748845 8:144274195-144274217 CAGGGCAGGGAGGGCGCCGCTGG - Intronic
1052781135 9:32783100-32783122 AAGGGCGGTCGGGGAGCCCCTGG + Intergenic
1059310989 9:113389091-113389113 GAGGGAGGTCAGGGTGCTGCAGG + Exonic
1059899156 9:118903592-118903614 CAGGGGGGTGGGGGGGCCGGTGG - Intergenic
1060722843 9:125989936-125989958 CAGGGATGTCCGGGGGCCCCTGG + Intergenic
1061046530 9:128168087-128168109 CAGGGTGGTGAGGGGCCAGCTGG - Intronic
1061805843 9:133137494-133137516 GAGGGAGGGCAGGGGGCCGGAGG + Intronic
1061995329 9:134180263-134180285 CAGGACGGCCAGAGGGGCGCGGG - Intergenic
1062389283 9:136327625-136327647 CAGGGCGGGCAGGGGGCGGACGG + Exonic
1062574545 9:137200179-137200201 GCGGGCGGGCTGGGGGCCGCGGG + Exonic
1062599622 9:137314044-137314066 CAGGGCAGCCTGGGGGCCTCAGG - Intronic
1203772472 EBV:56537-56559 CAGGTCGGTCAGGCGTCTGCGGG + Intergenic
1203773026 EBV:58994-59016 GCGGGAGGTCAGGGGGCGGCCGG + Intergenic
1203774334 EBV:64390-64412 CAGGGCCGACAGGTAGCCGCTGG - Intergenic
1185836011 X:3346483-3346505 CAGGGTGGCCAGGGCGCCCCAGG - Intronic
1186440621 X:9583126-9583148 CAGGGTGGTCAGGCGGCAGCAGG + Intronic
1189234661 X:39477889-39477911 CAGGGAGGTGACGGGGCAGCAGG - Intergenic
1190336277 X:49264569-49264591 CGGGGGGGTCAGGGGCCCTCTGG - Intronic
1195308377 X:103607919-103607941 CAGGGCGGGCGGGCGGGCGCGGG - Intronic
1196001987 X:110795972-110795994 GAGGGCGGGCAGGTGGCCCCGGG - Intergenic
1200104847 X:153706433-153706455 CTGGGCGGTTAGGAGGCCACTGG - Intronic
1200164269 X:154025359-154025381 CAGGGCAGGCAGGGGGCCTTGGG + Intronic
1200238046 X:154478641-154478663 GAGGGCGGGCGGGGGGCCGACGG - Intronic
1200239510 X:154486440-154486462 GAGGGCGGGCACGGGGCGGCCGG - Intronic