ID: 1138251189

View in Genome Browser
Species Human (GRCh38)
Location 16:55503053-55503075
Sequence CAGGCCAAGGAGCAGAGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 6, 3: 44, 4: 431}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138251189_1138251199 21 Left 1138251189 16:55503053-55503075 CCTGACCTCTGCTCCTTGGCCTG 0: 1
1: 0
2: 6
3: 44
4: 431
Right 1138251199 16:55503097-55503119 AAAGACTTCTCACAGCTGCAGGG 0: 1
1: 0
2: 1
3: 21
4: 182
1138251189_1138251198 20 Left 1138251189 16:55503053-55503075 CCTGACCTCTGCTCCTTGGCCTG 0: 1
1: 0
2: 6
3: 44
4: 431
Right 1138251198 16:55503096-55503118 GAAAGACTTCTCACAGCTGCAGG 0: 1
1: 0
2: 1
3: 19
4: 186
1138251189_1138251200 26 Left 1138251189 16:55503053-55503075 CCTGACCTCTGCTCCTTGGCCTG 0: 1
1: 0
2: 6
3: 44
4: 431
Right 1138251200 16:55503102-55503124 CTTCTCACAGCTGCAGGGCCTGG 0: 1
1: 0
2: 5
3: 58
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138251189 Original CRISPR CAGGCCAAGGAGCAGAGGTC AGG (reversed) Intronic
900294374 1:1941532-1941554 CAGGTAAAGGAGCAAATGTCAGG + Intronic
900987878 1:6083587-6083609 CCGGCCCAGGAGCAGAGGGCAGG - Intronic
901013443 1:6213741-6213763 CAGGACATGGAGGAGAGGGCAGG + Intronic
901061863 1:6475342-6475364 CATCCCAGGGTGCAGAGGTCTGG - Intronic
901432166 1:9223046-9223068 CAGGCCAGGGACCAGATGACTGG + Intergenic
902713435 1:18256157-18256179 CAGGCAAAGACCCAGAGGTCAGG - Intronic
902832233 1:19023208-19023230 CAGGCCAAAGTGCAGTGGTGTGG - Intergenic
902958288 1:19942184-19942206 CTGGCCAAGAAACAGAAGTCAGG - Intergenic
903378246 1:22879842-22879864 CAGGGCAAGGAGCCGAGCTGAGG + Intronic
903564625 1:24255469-24255491 GAGGCAAAGTAGCAGAGGTAAGG + Intergenic
903857565 1:26345859-26345881 CGGGCCAAGGAGCACAGGTCTGG - Exonic
904402244 1:30264403-30264425 CAGGCCAAGAAGCAGAGGCCTGG + Intergenic
904758730 1:32785518-32785540 CGGGCCAAGATGGAGAGGTCTGG + Intronic
904781424 1:32952024-32952046 CAGGCAAATCACCAGAGGTCAGG - Intronic
904863270 1:33556618-33556640 AAGGCCAGGGACCAGATGTCAGG + Intronic
905403716 1:37719826-37719848 AGGGCCAACGGGCAGAGGTCAGG + Intronic
905802737 1:40855820-40855842 CAGGCAAAGGAACAGAGGCTTGG + Intergenic
905826127 1:41027409-41027431 CAGGGCAAGGAGCTGTGGTGGGG + Exonic
906056983 1:42924995-42925017 CAGGGCAAGAAGGAGAGGCCGGG - Intergenic
907150780 1:52285388-52285410 CAGGCCACACAGCAGAGGTGAGG + Intronic
908016334 1:59841313-59841335 AAGGGCAAGGAGCAAAGGTGTGG + Intronic
908257376 1:62314239-62314261 CAGGCCAATCACCTGAGGTCAGG - Intronic
910427954 1:87134246-87134268 CAGGCCAAGGATTGGAGGGCCGG - Intronic
913086443 1:115441832-115441854 AAGGTCAGGGAGCAGAGGTAGGG - Intergenic
914908758 1:151768141-151768163 CGTGCCAATGGGCAGAGGTCTGG - Exonic
915010295 1:152679091-152679113 TGGGCCAAGGATCAGGGGTCTGG + Intergenic
915587617 1:156852641-156852663 CAGGGCAGGGAGCTGAGGTGGGG - Intronic
915922871 1:159990311-159990333 CAGGCCCAGAAGATGAGGTCCGG + Intergenic
916583653 1:166130805-166130827 CAGGAGAAAGAGCACAGGTCTGG - Intronic
917843917 1:179004475-179004497 CAGGCAAATCAGCTGAGGTCAGG + Intergenic
918627329 1:186671315-186671337 AAGGCCAAAGAGGAGAGGCCAGG + Intergenic
919125896 1:193393457-193393479 CAAGCTAAGGAGCTGAGATCAGG + Intergenic
920150993 1:203907623-203907645 CAGGCCAATCACCTGAGGTCAGG + Intergenic
920440615 1:205978361-205978383 CAGACTAAGGAGTAAAGGTCTGG - Exonic
921060496 1:211579967-211579989 CAAGGCAAGGAGCAGAGCCCAGG - Intergenic
921398541 1:214694578-214694600 CAGGCTAAGGGGCAGCGTTCAGG - Intergenic
923259904 1:232258534-232258556 GCGGCCAAGGAGCAGGGGTAAGG + Intergenic
923371339 1:233317184-233317206 CAGGCGAATCAGCTGAGGTCAGG + Intergenic
1064769151 10:18706117-18706139 CAGGCAAATGACCTGAGGTCAGG - Intergenic
1067256958 10:44650765-44650787 CAGGGGAAGGAGGAGAGCTCTGG + Intergenic
1070228746 10:74541240-74541262 CAGGCCAATCACCTGAGGTCAGG - Intronic
1070569714 10:77631783-77631805 CAGGCCAAACAGCAGGGGGCAGG + Intronic
1070617074 10:77977433-77977455 CAGGACAAGGAGTCAAGGTCAGG + Exonic
1070972457 10:80578811-80578833 AAGGCCAATGAGCAAGGGTCTGG + Intronic
1071307043 10:84308806-84308828 CAGTACAGGGAGCAGAGGGCAGG - Intergenic
1071504614 10:86225042-86225064 CAAGCCCAGGTGCAGAGGACTGG + Intronic
1071556055 10:86602314-86602336 CAGGCAAGAGAGCAGAGGGCAGG - Intergenic
1071948760 10:90678680-90678702 CAAGCCAAGGAGCAGATGTGGGG - Intergenic
1072133787 10:92523474-92523496 CAGGCAAATGACCTGAGGTCAGG + Intronic
1072849094 10:98867830-98867852 CAGGCCAACTACCTGAGGTCAGG + Intronic
1073571054 10:104581502-104581524 CAGGCCATGGAGCACAGGTGTGG + Intergenic
1074550587 10:114438662-114438684 CAGGCCCAGAAGCAGTGCTCTGG + Intronic
1074780128 10:116796551-116796573 CAGACCATGGAGCAGAGTGCAGG + Intergenic
1075427252 10:122351384-122351406 GAGGCCAAGGAGGAGAAGGCAGG - Intergenic
1075484866 10:122813977-122813999 CAGGCCAAGCAGGAGAGGTGCGG - Intergenic
1075484885 10:122814057-122814079 CAGGCCAAGCAGGAGAGGTGCGG - Intergenic
1075484904 10:122814137-122814159 CAGGCCAAGCAGGAGAGGTGCGG - Intergenic
1075484924 10:122814217-122814239 CAGGCCAAGCAGGAGAGATGTGG - Intergenic
1075484942 10:122814295-122814317 CAGGCCAAGCAGGAGAGATGGGG - Intergenic
1075799709 10:125145821-125145843 CTGGCCAGGGACCAGGGGTCTGG - Intronic
1076570100 10:131426838-131426860 TAGACCAAGGAGCAGAGGCTTGG + Intergenic
1077146623 11:1049346-1049368 GAGGCCAAGGAGCAGAGGGCTGG - Intergenic
1077289217 11:1781168-1781190 CAGGCCAAGGGCCTGAGGTCTGG - Intergenic
1077548570 11:3188751-3188773 CAGCCCTAGGAGGAGAGGTTTGG + Intergenic
1078397181 11:10991569-10991591 CAGGAAAAGGAGCATATGTCAGG + Intergenic
1078541481 11:12217008-12217030 AAGGCCACGAAGCAGAGGCCAGG - Intronic
1079589997 11:22171046-22171068 CAGGCCAATCACCTGAGGTCAGG + Intergenic
1079625564 11:22612739-22612761 CAGGCCATGGACCAGGGGTGGGG + Intergenic
1081080720 11:38736164-38736186 CTGGTCAAGGACCAGAGGTTGGG + Intergenic
1081505257 11:43709807-43709829 CAGGCCAAGCCACAGAGGTCAGG - Intronic
1081975368 11:47230891-47230913 CAGGCCAATCACCTGAGGTCAGG + Intronic
1083715969 11:64577172-64577194 CAGGCCCTGGAGCAGAGCTTTGG - Intergenic
1084578454 11:70006455-70006477 CAGGGCAGAGAGCAGAGGTAGGG - Intergenic
1084682480 11:70674574-70674596 CAGGCCAATTACCTGAGGTCAGG - Intronic
1085026493 11:73239581-73239603 CAGATCTAGGAGCAGAGGACTGG + Intergenic
1085260910 11:75204172-75204194 CAGGCCACAGAGCAGAGTCCAGG + Intronic
1085379975 11:76106797-76106819 GAGGGCAAGGAGCAGAAGTTGGG + Intronic
1085479647 11:76810647-76810669 CAGGCCAAGGAGCAGGGACAGGG - Intergenic
1085702242 11:78755647-78755669 CAGGCTGAGGAGCAGAGAGCAGG - Intronic
1085782212 11:79419762-79419784 CAGGCCAAGGAGTGGAGATGTGG - Intronic
1088567787 11:111191232-111191254 CAGACCAAGGGGCAGAATTCTGG + Intergenic
1089596470 11:119584174-119584196 CAGGCCAAGGAGGAGGGGCTAGG - Intergenic
1090178563 11:124673600-124673622 CAGGCTGAGGGGCAGGGGTCCGG + Intronic
1090189637 11:124759703-124759725 AAGGCCAAGTAACAGAGGTGGGG - Intronic
1090404776 11:126470014-126470036 CAGGCCCAGGAGCATGGATCGGG + Intronic
1090605722 11:128421414-128421436 CAGGCAGAGGACCAGAGCTCAGG - Intergenic
1091361392 11:134981084-134981106 CAGGACAAGGAAGTGAGGTCAGG - Intergenic
1091745056 12:2986408-2986430 CGGGCCAATCACCAGAGGTCAGG + Intronic
1091752758 12:3032940-3032962 CAGGCCAGGGAGCAGAAGACAGG - Intronic
1092378187 12:7973060-7973082 GAGGCCAAGGAGCGGGGGGCGGG - Intergenic
1093063005 12:14627081-14627103 CAAGCCTTGGTGCAGAGGTCAGG + Intronic
1094370202 12:29729446-29729468 CTGGCCCAAGAGCAGAGGACAGG + Intronic
1096072156 12:48781462-48781484 CTGCCCAGGGAGCAGAGGCCAGG - Intronic
1096511700 12:52133598-52133620 CAGGCCAAGGACCTAAGGTGGGG - Intergenic
1096532747 12:52252256-52252278 GAGGGCGAGGAGCAGAGGTGAGG - Intronic
1096673735 12:53215185-53215207 CAGGCCAAGTCTCAGAGGTCAGG + Intronic
1096736100 12:53656130-53656152 CAGGCAAATCAGCTGAGGTCAGG - Intronic
1096964273 12:55612623-55612645 CAGGCCAAGAGGCAGGAGTCAGG + Intergenic
1097049674 12:56214599-56214621 CAGGCAGATGAGCTGAGGTCAGG + Intronic
1097143640 12:56924691-56924713 CAGGCCAATCACCTGAGGTCAGG + Intronic
1097248977 12:57621934-57621956 GAGGCCACGGAACAGAGGGCCGG + Intronic
1098881516 12:75922018-75922040 AAGGCCACGGAGGAGAGCTCAGG - Intergenic
1099664376 12:85609060-85609082 CAGGCCAATCACCTGAGGTCAGG + Intergenic
1099977363 12:89559913-89559935 AAGGCCCAGCAGCAGAGGTATGG + Intergenic
1099979796 12:89585279-89585301 GAGGCCGAGGTGGAGAGGTCAGG + Intergenic
1100614441 12:96220185-96220207 CAGGCAGAGGAGCAGTGGTGGGG - Intronic
1100702061 12:97159609-97159631 CAGGTCAAAGGGCAGAAGTCAGG + Intergenic
1101497276 12:105266790-105266812 AAGTCCATGGAGCAGAGATCTGG + Intronic
1101682911 12:106986936-106986958 CACGCCCAGGAGCAGAGGAAGGG + Exonic
1103119676 12:118371385-118371407 CGGGCCAGTGAGAAGAGGTCAGG + Intronic
1103442174 12:120971347-120971369 AAGGCCAACGAGCAGAGGGTTGG + Intergenic
1103539987 12:121659329-121659351 CAGGGAAAGGAACACAGGTCTGG - Exonic
1103638874 12:122332066-122332088 GAGGCCAAGGCCCTGAGGTCAGG + Intronic
1104884070 12:132094627-132094649 CAGGACAAGCAGCAGAGGCATGG - Intronic
1104891772 12:132143731-132143753 CAGGCCGGGGACCAGGGGTCCGG + Exonic
1106474096 13:30082533-30082555 CTGTCCAAGGAGCAGAGGCATGG + Intergenic
1108438270 13:50422693-50422715 CAGGACAAAGGGCAGAGCTCAGG + Intronic
1111331260 13:86763481-86763503 CAGGCCAAGGAGCTGCGGGAGGG + Intergenic
1113164480 13:107423272-107423294 CAGTCTGAGGAGCAGAGGTCAGG + Intronic
1113734626 13:112669545-112669567 CAGGCCAATTACCTGAGGTCAGG + Intronic
1113797341 13:113066154-113066176 CAGGCCACCGTGCAGAGGTGAGG + Exonic
1114401694 14:22416145-22416167 AAGGACAAGGAGCAGAAGACTGG + Intergenic
1115961294 14:38837863-38837885 CAGCCCTGGGACCAGAGGTCTGG + Intergenic
1115985524 14:39101069-39101091 CAGGCCAATCACCTGAGGTCAGG - Intronic
1116672412 14:47860509-47860531 CAGGACAAGGAGTAGTGGTCAGG + Intergenic
1116738773 14:48728736-48728758 AAGGCCAAGGACACGAGGTCAGG + Intergenic
1118358383 14:65035191-65035213 CAGGCCAGGGGTCAGGGGTCAGG - Intronic
1118749228 14:68794454-68794476 CGGGCCAAGGCGCAGGGGGCGGG - Intronic
1118775308 14:68970195-68970217 CAGGCCAAAGAGCAGTCGGCTGG - Intronic
1119820771 14:77614741-77614763 CAGGCCAATCACCTGAGGTCAGG + Intronic
1121611355 14:95283016-95283038 CATGCCATGGAGCACAGGGCTGG - Intronic
1121633359 14:95437407-95437429 CAGGCCCAGGCTCAGAGGACAGG - Intronic
1121649353 14:95545733-95545755 CAGGCCGTGGACCAGAGGCCGGG + Intergenic
1122371720 14:101232846-101232868 CAGGCCCAGGAGCTGGGGTCTGG + Intergenic
1122548227 14:102536587-102536609 CAGGAGAGGGAGCAGAGTTCAGG + Intergenic
1122699324 14:103576869-103576891 CTGGCAAAGGATCAGAGGGCTGG + Intronic
1122974712 14:105166354-105166376 CAGGCCCAGGTGCAGATGACAGG + Intronic
1123042882 14:105497619-105497641 AAGGCCATGGAGCTGAGGGCGGG - Intronic
1123501309 15:20884058-20884080 CAGGCCAATCACCTGAGGTCAGG - Intergenic
1123558562 15:21457763-21457785 CAGGCCAATCACCTGAGGTCAGG - Intergenic
1123594791 15:21895038-21895060 CAGGCCAATCACCTGAGGTCAGG - Intergenic
1126781495 15:52142925-52142947 CAGGCCAATCACCTGAGGTCAGG + Intronic
1126851864 15:52801909-52801931 CGGGCCAAGGGTCAAAGGTCAGG + Intergenic
1127671523 15:61199536-61199558 CAGGGCAGGCAGCACAGGTCTGG - Intronic
1127854934 15:62946461-62946483 CTCGCCAGGGAGCAGTGGTCAGG + Intergenic
1128992520 15:72272575-72272597 CAGGCCAAGGGGCGGGGGCCGGG + Exonic
1129363929 15:75042982-75043004 CAGGCCAAGGCGCTGGGGGCTGG - Intronic
1131177566 15:90219684-90219706 CAGTCCTGGGAGCAGAGGCCGGG + Intronic
1131443263 15:92474726-92474748 CAGGCCTAGAAACTGAGGTCTGG - Intronic
1131475582 15:92735916-92735938 CAGTGCAAGGAGCACAGGTTGGG + Intronic
1131514982 15:93071460-93071482 CTGGCCAAGGACAAGATGTCGGG - Intronic
1132404378 15:101533485-101533507 CAGGGCAGGGAGCAGTGGTGGGG - Intergenic
1202966910 15_KI270727v1_random:184916-184938 CAGGCCAATCACCTGAGGTCAGG - Intergenic
1132495961 16:263560-263582 CAGGACACGGAGCCGACGTCTGG - Intronic
1132704489 16:1237216-1237238 GGGGCCAAGGGTCAGAGGTCGGG + Intergenic
1132707025 16:1249209-1249231 GGGGCCAAGGGTCAGAGGTCGGG - Intergenic
1133218986 16:4310354-4310376 AAGGTCAAGGGCCAGAGGTCTGG + Intergenic
1134378397 16:13701229-13701251 CAGGCCCAGGAGAAGGGGTAAGG - Intergenic
1135353921 16:21753831-21753853 CAGGCCAATCACCTGAGGTCAGG + Intronic
1135452410 16:22569970-22569992 CAGGCCAATCACCTGAGGTCAGG + Intergenic
1136004479 16:27319215-27319237 GAGGTCTAGGAGCAGAGGTCAGG + Intronic
1136469509 16:30470088-30470110 CAGGCAAATCAGCTGAGGTCAGG - Intergenic
1137612569 16:49828794-49828816 CCGGCTATGGAGGAGAGGTCTGG + Intronic
1138187139 16:54985410-54985432 GAGGCCAAGGATCAAAGGTGTGG - Intergenic
1138208327 16:55141812-55141834 TAGGCCAAAGAGCAGGGGTCTGG + Intergenic
1138251189 16:55503053-55503075 CAGGCCAAGGAGCAGAGGTCAGG - Intronic
1139269855 16:65671827-65671849 CAGGCAGAGGAGCAGAAGTGAGG - Intergenic
1139350378 16:66331295-66331317 GAGACCAAGGAGCAGGGCTCAGG - Intergenic
1141528123 16:84626564-84626586 CAGGCGAATCACCAGAGGTCGGG - Intergenic
1142068308 16:88075116-88075138 CAGGCCAATCACCTGAGGTCAGG + Intronic
1142239325 16:88938033-88938055 CAGGGCAGGAAGCAGAGGTGGGG + Intronic
1142631153 17:1227799-1227821 GGGGCTAAGGAGGAGAGGTCAGG - Intronic
1142646709 17:1318606-1318628 CGGGCCAATCAGCTGAGGTCGGG - Intergenic
1142814769 17:2416525-2416547 CAGGACACACAGCAGAGGTCTGG + Exonic
1143067698 17:4263276-4263298 GAGGCAAAGGCACAGAGGTCTGG + Intronic
1143401850 17:6651428-6651450 GAGGCCACGGGGAAGAGGTCTGG + Intronic
1143758385 17:9083321-9083343 CAGGCCAATCACCTGAGGTCAGG - Intronic
1144998467 17:19287176-19287198 CAGGCGAAGGTGCAGAGGCAGGG - Intronic
1146057512 17:29588849-29588871 GAGGGCAAGGAGCAGAGGGCCGG - Intronic
1147171203 17:38620092-38620114 CAGGACAAGGAGCAGAGCTGTGG - Intergenic
1147959292 17:44156449-44156471 CAGGCCAATCACCTGAGGTCAGG - Intronic
1148148972 17:45384932-45384954 GAGGACAAGGAGCCGAGGACGGG + Intergenic
1148187896 17:45657749-45657771 CAGGTCAAGCAGCTGAGGTGGGG + Intergenic
1148970405 17:51475784-51475806 CAGGCCCAGGCTCAGAGGACAGG - Intergenic
1149345419 17:55729413-55729435 CAGGACAAGGAGTAGATGTGGGG + Intronic
1149579852 17:57742031-57742053 CAGGCCCAGGAGCAGAGTTGTGG + Intergenic
1149778942 17:59381017-59381039 AAGGCCAAGGAGGAGAGGTAGGG + Intronic
1150151007 17:62808572-62808594 CAGGGAAGGGAGCAGAGGCCTGG - Intergenic
1150739205 17:67765934-67765956 AAGGCAAAGGAGAAGAGGTTGGG + Intergenic
1151155068 17:72118314-72118336 CAGGTCAGGGAGGAGGGGTCGGG + Intergenic
1151483520 17:74384341-74384363 CAGGCCACTGAGCCGAGCTCTGG - Intergenic
1151513320 17:74575801-74575823 CAGGCCAATCACCTGAGGTCAGG + Intergenic
1151729044 17:75900203-75900225 CAGGCCAGGGGGCAGAGGTCAGG - Intronic
1151917028 17:77125922-77125944 CAGGCAAATCACCAGAGGTCAGG + Intronic
1151987759 17:77555192-77555214 CAGGCCATGGCCCAGAGGGCAGG + Intergenic
1152159745 17:78660157-78660179 CAGGCCAATGACCAGAGCACAGG + Intergenic
1152293491 17:79453893-79453915 CATGCCCAGGAGCTGAGTTCTGG + Intronic
1152553873 17:81043422-81043444 CAGGCCGTGGAGCAGAGCTGTGG + Intronic
1152739461 17:82012628-82012650 CAGGCCTCGGAGCAGGGCTCAGG + Intronic
1153062409 18:1007718-1007740 CAGGCCAAGGAGCAAATGTAGGG + Intergenic
1154069631 18:11141647-11141669 CAGGCTAAGGAGCAGACGAACGG + Intronic
1155182181 18:23357532-23357554 CAGGCCAAGGCCCAGGGGTCTGG - Intronic
1156270370 18:35525039-35525061 CAGGCCAAGGAGAAGAGGAGAGG - Intergenic
1157586144 18:48802503-48802525 CAGGCCCAGGATCAGAGACCTGG + Intronic
1158556347 18:58477818-58477840 CAGGCCAATCACCTGAGGTCAGG - Intergenic
1160013820 18:75125864-75125886 CAAGCCCGGGAGCAGAGCTCGGG + Intergenic
1160050042 18:75424820-75424842 CAGGCTAAGGAGCAGAGATCTGG + Intronic
1160229864 18:77039628-77039650 CATGCCAGGGGACAGAGGTCAGG + Intronic
1160724946 19:613758-613780 CTGGCCAAGGTGCAGAGGCCGGG + Intronic
1161014746 19:1978128-1978150 CAGGCCATGGTGCAGTGCTCTGG + Intronic
1162786685 19:13039478-13039500 CAGGCAAGGTAGCAGAGCTCAGG - Intronic
1163440713 19:17321357-17321379 CAGGCGAAGCACCTGAGGTCAGG - Exonic
1164504475 19:28848050-28848072 CTGGCAAATGAGCTGAGGTCAGG - Intergenic
1164598135 19:29543599-29543621 CAGGACAAGGAGCTGAAGCCTGG + Intronic
1164848830 19:31462015-31462037 CAGGGCAAGGAAGAGAGGTGGGG + Intergenic
1164883796 19:31760181-31760203 CACACCAAGGACCAGGGGTCAGG - Intergenic
1166229718 19:41419352-41419374 CAGGCAAAAGAGCTGAGGCCTGG - Intronic
1166368546 19:42289446-42289468 CAGGCCAAGGCTCAGAGGGTGGG + Intronic
1166392799 19:42419389-42419411 CAGGACAAAGGGCAGAGCTCTGG - Intronic
1166406438 19:42525179-42525201 AAGTCCAGGGAGCAGAGGTGTGG + Intronic
1166720785 19:44994644-44994666 CAGGCCATGGTGCAGAGGCTGGG - Intergenic
1167447006 19:49543561-49543583 CAGGCCAGGCAGGAGAGGGCTGG - Exonic
1168146878 19:54424573-54424595 CAGGAGAAGGAGCTGAGGCCCGG - Intronic
925276497 2:2652622-2652644 CAAGCCAGGGAGCCCAGGTCTGG + Intergenic
926688653 2:15717712-15717734 GAGGCAAAGGATCTGAGGTCAGG - Intronic
927065490 2:19466874-19466896 CAGGTCAAAGACCAGAGGTAGGG - Intergenic
927150592 2:20193161-20193183 CAGGCCCAGGGCCAGAGGGCAGG - Intergenic
927151502 2:20198896-20198918 CTGGCCATGGAGCAGAGGTGAGG - Intergenic
927210203 2:20634490-20634512 CAGGCCCATGCGCAGTGGTCGGG + Intronic
928105430 2:28467795-28467817 GAGGCAAAGGAGCAGAAGCCAGG + Intronic
928347869 2:30517497-30517519 CTGGCCAAGGAGCTGAGGCTTGG - Intronic
928433870 2:31241178-31241200 CAGGCCTTGGAGGAGAGGTGAGG - Intronic
929476813 2:42259017-42259039 CAGGCGAATCAGCTGAGGTCAGG + Intronic
929628402 2:43433914-43433936 CAGGCCAATCACCTGAGGTCAGG - Intronic
930378546 2:50597909-50597931 CAGGCCAATTACCTGAGGTCAGG + Intronic
931463898 2:62470559-62470581 CTGGCCAAGGAGGTGAGGGCTGG - Intergenic
932621832 2:73269341-73269363 CAGGGCAAGGAGCAGGCGGCCGG - Exonic
934766783 2:96884253-96884275 CTGGCCCAAGAGCAGATGTCTGG + Intronic
935891965 2:107688559-107688581 CAGGGCAAGAAGCAGAGCTGAGG + Intergenic
936062685 2:109305897-109305919 CAGCCCAAAGGGCAGAGCTCAGG - Intronic
937091687 2:119210769-119210791 GAGGCCAAGTACCTGAGGTCAGG - Intergenic
937118936 2:119428848-119428870 CAGGCCTAGAAGCAGGGGTCAGG + Intergenic
937147451 2:119659802-119659824 GGGGCCAAGGGGCAGAGGCCTGG - Intronic
937924149 2:127154661-127154683 GAGGCCAAGGAGCTGAGTCCTGG + Intergenic
938157898 2:128957157-128957179 CTGCAGAAGGAGCAGAGGTCTGG - Intergenic
938190394 2:129274288-129274310 CAGGAAAAGGAGCAGAGGACAGG - Intergenic
938245979 2:129778395-129778417 CAGGCCAAGGCTCAGTGGTCAGG + Intergenic
938970146 2:136424352-136424374 CAGCCCAAAGAGCAGAGGCTTGG + Intergenic
939610024 2:144298706-144298728 CAGGAAAGGGAGGAGAGGTCAGG + Intronic
940414893 2:153408227-153408249 CAGGCCAGGGAGCTGACTTCTGG + Intergenic
940670423 2:156660918-156660940 CAGGCCATGGACCAGGGGTTGGG - Intergenic
941150229 2:161905463-161905485 CAGGCCATGGACCAGGGGTTGGG + Intronic
942871820 2:180743507-180743529 CTGGCCAATGAGCAGAAGTATGG - Intergenic
943370492 2:187010217-187010239 AGGGCCAAGGAGCAGAGTTAAGG + Intergenic
943704797 2:191023077-191023099 CAGCCCAAGGAGCAAAGGAAAGG + Intergenic
944447168 2:199803393-199803415 CAGGCCTAGGAAGAGAGGCCTGG + Intronic
944787351 2:203086760-203086782 CAGGCCAATCACCTGAGGTCAGG - Intronic
945241870 2:207683582-207683604 CAGGCAAAGGGGCAGAGCTGAGG + Intergenic
945557601 2:211298650-211298672 CAGGTCAAGGACCAGAGGGGAGG + Intergenic
946171504 2:217898583-217898605 AAGGCCAAGGAACAAAGGGCAGG - Intronic
947025499 2:225733584-225733606 CAGGCCTAGGAACAGAATTCAGG - Intergenic
947358177 2:229318494-229318516 CAGGCCAATTACCTGAGGTCAGG - Intergenic
948342869 2:237269230-237269252 CAGGGAAAAGAGCAGAGGTGTGG - Intergenic
948600712 2:239106163-239106185 CAGGCAGAGGAGCCGAGGGCGGG + Intronic
948862236 2:240758211-240758233 CAGGCCAGGGAGGACAGGGCTGG + Intronic
948863278 2:240763160-240763182 CAGGAGATGGAGCAGAGGTGAGG - Exonic
949017482 2:241721578-241721600 AAAGCCAAGGAGCAGAAGTCTGG - Intronic
1168953664 20:1819551-1819573 CAGGCGAAGGAGAGGAGGTGGGG - Intergenic
1168991904 20:2102717-2102739 CAGGCCAAGGCGGGGAGGCCAGG - Intronic
1169136317 20:3199961-3199983 CTGGTCAAGGGTCAGAGGTCAGG + Intronic
1169442525 20:5644543-5644565 CAGGCCAATCACCTGAGGTCAGG + Intergenic
1170029644 20:11931560-11931582 CAGGTCAACTAGCAGAGATCAGG - Intergenic
1170189869 20:13634799-13634821 CAGGCCAATCACCTGAGGTCGGG + Intronic
1171026723 20:21637587-21637609 GAGGACAAGTAGCAGAGGTGAGG + Intergenic
1171364876 20:24616925-24616947 CAGGCCACGTAGCAGAGCCCCGG + Intronic
1171950541 20:31417733-31417755 CAGGCCAATCACCTGAGGTCAGG + Intergenic
1172786071 20:37469670-37469692 AATGCCAAGGAGAAGAGGCCTGG - Intergenic
1172864963 20:38088881-38088903 TAGTCCAAGGAGCAGAGGAGTGG + Intronic
1173408500 20:42788485-42788507 CAGGCCAAGGAGATGAGGCTGGG + Intronic
1174143016 20:48430133-48430155 GAGGCCAAGGAGGAAAGGTGAGG - Intergenic
1174301560 20:49585932-49585954 CAGGCCAGAGGTCAGAGGTCAGG + Intergenic
1174375331 20:50123042-50123064 CAGGCTAAAGTGCAGAGGTGAGG - Intronic
1174513410 20:51073122-51073144 CAGGGCAAGGTCCAGAGGTGTGG - Intergenic
1174587191 20:51618436-51618458 CTGGCAAAGGAGTAGAGGCCTGG + Intronic
1175836315 20:61997544-61997566 CGGGCTCAGGAGCAGAGGTACGG - Exonic
1176195400 20:63834553-63834575 CAGGGCAAGGTGCAGAGGCTGGG + Intergenic
1176198466 20:63848537-63848559 CAGGGCAGTGAGCAGAGGTCGGG - Intergenic
1176968155 21:15235143-15235165 CAGGCAAAAGAGAAGAGGGCAGG - Intergenic
1178023471 21:28436749-28436771 CAGGCCAAGGAACAAAAGCCAGG + Intergenic
1179149493 21:38797663-38797685 TGGGACAAAGAGCAGAGGTCTGG + Intergenic
1179627542 21:42657248-42657270 CAAGCCAAGGAACAGATGACGGG - Intronic
1180003085 21:45003916-45003938 CAGGCCCACGAGGAGAGGTCAGG + Intergenic
1181007096 22:20018850-20018872 CAGGCAAATCACCAGAGGTCAGG + Intronic
1181098022 22:20519496-20519518 CAGGCCAGTGAGCCGAGGTCAGG - Intronic
1181175472 22:21032452-21032474 CAGGCGAAGGCGCAGGTGTCCGG - Intronic
1181602185 22:23959215-23959237 CAGGAAAAGGACAAGAGGTCAGG - Intronic
1181606324 22:23982092-23982114 CAGGAAAAGGACAAGAGGTCAGG + Intronic
1181684658 22:24520161-24520183 CAGGGCAAGGTGCTGAGGACAGG + Intronic
1182103090 22:27671094-27671116 CAGACCAGGAAGCAGAGGCCTGG - Intergenic
1182264517 22:29103345-29103367 CACACCAAGGGGCAGAGATCTGG - Intronic
1183688423 22:39375069-39375091 GAAGTCACGGAGCAGAGGTCAGG - Intronic
1183752390 22:39729078-39729100 CAGTCGAAGGAACAGAGGCCTGG + Intergenic
1184100836 22:42341134-42341156 AAAGGCAAGGAGCAGAGGCCAGG - Intronic
1184115099 22:42417648-42417670 CAGGCCAGGCAGGAGAGTTCAGG - Intronic
1184212287 22:43043239-43043261 CCGGCCAAGAAGCAGAGGCCAGG - Intronic
1184684587 22:46090385-46090407 CAGGCCAGGAAGCCCAGGTCTGG + Intronic
1185225482 22:49649394-49649416 CAACCCAAGGAGCAGATGTTGGG - Intronic
950663697 3:14482360-14482382 CAGGCACAGAGGCAGAGGTCTGG - Intronic
953044185 3:39280788-39280810 CAGGCCAGGGAGCAGAAGCATGG - Intronic
954572654 3:51655003-51655025 CAGGCCAGATAGCACAGGTCTGG + Intronic
958436259 3:94099559-94099581 CAGGCCAGGAAGCAGAGGCAGGG - Intronic
959567685 3:107849280-107849302 GAGGCCAAAGAGCAGAGGACAGG + Intergenic
960728907 3:120702500-120702522 CAGGCCATGGACCAGGGGTTGGG + Intronic
961104334 3:124228298-124228320 CAGGCCAGGGGGCTGAGGTTGGG - Intronic
961825294 3:129596180-129596202 CAGACCACGGAGCAGAGGCTCGG + Intronic
962118339 3:132535593-132535615 CAGGAAAAGGAACAGAGGCCAGG + Intronic
962223271 3:133582377-133582399 CAGGCCGATGACCTGAGGTCAGG - Intronic
962748902 3:138418293-138418315 CAGGCCAGAGCCCAGAGGTCAGG - Intergenic
963225975 3:142862042-142862064 CAAGCCTAGCAGAAGAGGTCAGG - Intronic
963946735 3:151153794-151153816 CAGGCCAATCACCTGAGGTCAGG - Intronic
964203804 3:154148154-154148176 CAGGCCCAGGAGCAGCGGCCTGG + Intronic
964734362 3:159901137-159901159 TAGGCCAAGGGGCAGGGGGCTGG - Intergenic
966791287 3:183672765-183672787 CAGGCCAATCACCTGAGGTCGGG + Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
968258537 3:197299523-197299545 TAGGACAAGGAACCGAGGTCCGG + Intergenic
968444146 4:640306-640328 CAGGCCAATCACCTGAGGTCAGG + Intronic
970925686 4:21449112-21449134 CAGCCCAAAGAGCAGAGGTATGG + Intronic
972978234 4:44663725-44663747 CAGGCAAAGGCGCAGAGGGTAGG - Intronic
974115800 4:57577933-57577955 CAGGCAAAGGAGCAGGGTTCTGG - Intergenic
976163125 4:82225054-82225076 CAGATGAAGGAGCAGTGGTCTGG - Intergenic
977501550 4:97846099-97846121 CAGGCCAAAGGATAGAGGTCTGG + Intronic
978105907 4:104901595-104901617 CAGGCAGAGGAGCAGAGGAGTGG + Intergenic
978516085 4:109569728-109569750 CAGGCCAATCACCTGAGGTCAGG - Intronic
982205784 4:152996295-152996317 CTGGCCATGGATCTGAGGTCAGG - Intergenic
984855924 4:184196118-184196140 CAAGCCAAGGGGCAGAGATGGGG - Intronic
984932231 4:184858028-184858050 CAGGCCAAGGAGCCCAGCTCAGG + Intergenic
985785247 5:1889889-1889911 CAGGATACGGAGCAGAGGCCAGG - Intergenic
986648975 5:9945325-9945347 TGGTCCAAGGAGCAGAGGACTGG - Intergenic
987317592 5:16738298-16738320 CAGGCCTGGGAGCAGGGGTGGGG + Intronic
988786208 5:34567637-34567659 CAGGCGAATCAGCTGAGGTCAGG + Intergenic
989327807 5:40220411-40220433 CAGGCCAAGAAACAGAGGAAGGG + Intergenic
990735400 5:58855446-58855468 CACGCAAAGGAACAGAGTTCCGG - Exonic
991406466 5:66305350-66305372 GGGGCTGAGGAGCAGAGGTCTGG + Intergenic
992997494 5:82347480-82347502 CAGTGGAAGGAGCTGAGGTCTGG + Intronic
993078822 5:83270281-83270303 TAGGCCATGGACCAGAGGTTGGG + Intronic
993105589 5:83596776-83596798 CAGGCCAATCAACTGAGGTCAGG - Intergenic
993196936 5:84761012-84761034 CAGGCCAATCACCTGAGGTCAGG - Intergenic
993717832 5:91293311-91293333 CAGGCAATGCAGCAGGGGTCTGG - Intergenic
996153633 5:120071209-120071231 CAGGCCAATCACCTGAGGTCAGG + Intergenic
996493262 5:124124321-124124343 CATGCCAAGGAGCAGAGCTAAGG - Intergenic
997357245 5:133271023-133271045 CAGGCCTGGAAGCAGAGCTCAGG - Intronic
997590101 5:135067128-135067150 CATGCCAGGGAGGAGGGGTCGGG - Intronic
999083565 5:148866907-148866929 CATGCCAAAGAGCAGGGGCCTGG + Intergenic
999633715 5:153598530-153598552 AATGCCAAGCAGCAGAGGTGAGG + Intronic
999888534 5:155951020-155951042 CAGGGCCAGGAGCAGAGTTGAGG + Intronic
1000201538 5:159015609-159015631 GAAGTTAAGGAGCAGAGGTCTGG - Intronic
1000750841 5:165095338-165095360 CAGGCGAATCAGTAGAGGTCAGG + Intergenic
1001034313 5:168286603-168286625 CAAGCCCATGAGCAGAGGGCGGG - Intergenic
1001412082 5:171519160-171519182 CAGGCACAGGAGCAGGGGTGTGG + Intergenic
1002110845 5:176910861-176910883 CAGGCCAATCACCTGAGGTCAGG + Intronic
1002175688 5:177399921-177399943 CGCGCCAAGGAGCAGCAGTCAGG + Intergenic
1002185590 5:177453455-177453477 CAGGCCCAGGAGAAGGGGACTGG + Intronic
1002301384 5:178259269-178259291 CTGGCCCAGGAGAAGAGGCCGGG + Intronic
1002332353 5:178453006-178453028 AATGCCCATGAGCAGAGGTCTGG + Intronic
1002661030 5:180791271-180791293 CAGGTCAGGGAGAAGGGGTCTGG + Exonic
1002886088 6:1295525-1295547 GATGCCAGGGAGCAGAAGTCAGG - Intergenic
1003071283 6:2947390-2947412 CAGGTAAAGGAGGAGAGGCCAGG + Intergenic
1003222624 6:4174907-4174929 CAGGCCAATCACCTGAGGTCAGG + Intergenic
1003289983 6:4772255-4772277 CTGGCCAAGGAGCAGCAGTGTGG + Intronic
1003557697 6:7155536-7155558 CAGGCCAATCACCTGAGGTCAGG - Intronic
1004196155 6:13507100-13507122 CAGGCCGATCATCAGAGGTCAGG + Intergenic
1004352724 6:14904320-14904342 CAAGCCAAGGATCAGAAGTCAGG + Intergenic
1005090337 6:22050132-22050154 CAGGCTAAAAAGCAGAGGCCCGG + Intergenic
1007004690 6:38349763-38349785 CAGGCCAAGGAGAAGACTTCAGG + Intronic
1007695457 6:43729904-43729926 TAGGCAAAGGAGCAGAGGCCGGG + Intergenic
1007729406 6:43936779-43936801 CAGGCCCAGCAGCTGAGGCCAGG - Intergenic
1007749096 6:44061110-44061132 CTGGCCAAGGAGGAGAGCTTGGG - Intergenic
1007752421 6:44078432-44078454 CCTGGCAGGGAGCAGAGGTCAGG + Intergenic
1007806410 6:44452685-44452707 AAGGCCAAGGAGGGGAGTTCAGG + Intergenic
1013656885 6:112255189-112255211 CAGGCCAAGAGGAAGAGGCCGGG - Intergenic
1015889513 6:137955486-137955508 CAGGGCAAGAAGAAGAGGGCGGG + Intergenic
1016795685 6:148114756-148114778 CAGAGCAGGGAACAGAGGTCTGG + Intergenic
1017710128 6:157160196-157160218 CAGGTCAGGAAGCAGAGGTTTGG - Intronic
1017900466 6:158715060-158715082 CAGGCCAAGGGGCACAGAGCAGG - Intronic
1018540620 6:164875655-164875677 CAGGTCAGGGAACACAGGTCAGG - Intergenic
1019075123 6:169380727-169380749 GAGGCCCAGGAGCAGAGGCTGGG + Intergenic
1019134274 6:169898422-169898444 CAGGCCAAGGTGCTTAGCTCAGG + Intergenic
1019473911 7:1235152-1235174 CAGGCCAAGGACCGCAGGTTTGG + Intronic
1020029253 7:4921234-4921256 CAGTCCAAGCAGATGAGGTCAGG - Intronic
1021927362 7:25546250-25546272 CAGGGCAAGGAGGAGGGGTTGGG + Intergenic
1022483546 7:30759942-30759964 CCGTCCAAGGAGCAGAGCCCCGG - Intronic
1023439581 7:40172196-40172218 CTGGCCAAGGAGCCGAGGCTTGG + Intronic
1024568315 7:50702560-50702582 CTGGTCACGGAGCAGAGGTAGGG + Intronic
1024973061 7:55088166-55088188 CATGGAAAGGAGCAGTGGTCTGG + Intronic
1026069806 7:67108667-67108689 CGGGCAAAGCAGCTGAGGTCAGG - Intronic
1028385070 7:90245200-90245222 CCGGCCCGGGATCAGAGGTCTGG + Exonic
1029113436 7:98224668-98224690 CTGGCCAAGGAGCAGACCCCTGG - Intronic
1029287889 7:99478766-99478788 CAGACCAAGGCGCAGACGCCTGG - Intronic
1029459582 7:100687241-100687263 CAGGCCAGGGAGGGGAGGCCTGG - Intronic
1029515317 7:101019923-101019945 CAGGCCAAAGGGCAGAGGGAGGG - Intergenic
1029730601 7:102435471-102435493 GAGGGCAGGGAGCAGAGGACTGG - Intronic
1030028863 7:105350747-105350769 GAGGCCAAGGTGGGGAGGTCAGG - Intronic
1031305638 7:120123179-120123201 CAGGCAGATGACCAGAGGTCAGG - Intergenic
1032160198 7:129503652-129503674 CAGGCAAAGCACCAGAGGTGAGG - Intronic
1032474335 7:132202119-132202141 CAGGCCATGGAGCAAAGACCTGG - Intronic
1032708636 7:134443565-134443587 CAGGGCAGGGAGCACAGGGCAGG + Intronic
1032888185 7:136164696-136164718 CAGGCCAGGGAGCAGTGGTGCGG - Intergenic
1033672709 7:143508476-143508498 CAGGCCAATCACCTGAGGTCGGG - Intergenic
1034081923 7:148287077-148287099 CCGGGCAAGGAGCAGAGGGGAGG - Intronic
1034219025 7:149430283-149430305 CAGAGGAGGGAGCAGAGGTCTGG - Intergenic
1034429238 7:151032875-151032897 CAGGCCAGGGAGGGGAGGTAGGG + Intronic
1034562507 7:151890311-151890333 CAGGAGAAGGAGCAGAGGAAGGG - Intergenic
1034696398 7:153057978-153058000 CAGGCTCAGGAGCAAAGATCGGG - Intergenic
1034819473 7:154203450-154203472 CAGGCTTCTGAGCAGAGGTCAGG - Intronic
1035375510 7:158404667-158404689 GAGGCCAAGGAGCTGGGGGCCGG - Intronic
1036402934 8:8426424-8426446 TAGGCCAGGGTGCAGAGGTTGGG + Intergenic
1036509328 8:9386051-9386073 CAGGCCCTGGAGCAGAGGAGTGG + Intergenic
1036769778 8:11571085-11571107 CTGGCCATGGAGCTGAGCTCAGG - Intergenic
1036794668 8:11746838-11746860 CAGGCCAGGGAGCGGAGCACAGG - Intronic
1037620154 8:20556339-20556361 CAACCCATGGAGAAGAGGTCAGG - Intergenic
1037922672 8:22818524-22818546 CAGGGGAGGGAGCAGAGGCCAGG + Intronic
1038412354 8:27368316-27368338 CAGGCCAAGGAGCAGGGTGGGGG - Intronic
1039434020 8:37547297-37547319 CAAGCCAAGGAGGAGGGGGCTGG - Intergenic
1039622205 8:39008399-39008421 CAGGCGAATGACCTGAGGTCAGG - Intronic
1040559583 8:48512516-48512538 CAGGTGAAGAAACAGAGGTCAGG - Intergenic
1042924831 8:73956161-73956183 CAGGCCAATCACCTGAGGTCAGG + Intronic
1043013587 8:74910512-74910534 CAGGCCATGAACCAGAGGTTGGG - Intergenic
1044607286 8:94058285-94058307 AAGGCCAAGGAGTAGAGGTCAGG - Intergenic
1044628352 8:94256206-94256228 CAGGCCAAGGAGCAGGTGGGAGG - Intronic
1045051966 8:98335675-98335697 CAGCCCCAGGAGCAGAAGGCTGG - Intergenic
1045614482 8:103892735-103892757 CAGGCCAATTACCTGAGGTCAGG - Intronic
1047080252 8:121452539-121452561 CAGGACAAGGAGCATAAGCCAGG + Intergenic
1047200232 8:122759076-122759098 CTGGCCTAGAAGCAGAGCTCAGG + Intergenic
1047495820 8:125407980-125408002 CTGGAGAAGGAGCTGAGGTCTGG - Intergenic
1049218034 8:141416732-141416754 CAGGCTGGGGAGCAGAGGACAGG - Intronic
1049558534 8:143296004-143296026 CAGGCCCCGGCGCAGAGGGCGGG + Exonic
1049784548 8:144444239-144444261 AAAGCCAAGGCGCAGAGGGCCGG - Exonic
1050002720 9:1095699-1095721 AAAGACAAGGAGCAAAGGTCAGG + Intergenic
1050021148 9:1285771-1285793 AGGGCCAAGGAGGAGAGGGCAGG - Intergenic
1050273030 9:3966566-3966588 CAGGCCAATCACCTGAGGTCAGG + Intronic
1050615025 9:7392922-7392944 CAGGCCAATCACCTGAGGTCAGG - Intergenic
1053161198 9:35814677-35814699 CAGGCCGGGGCGCCGAGGTCGGG - Intronic
1053272759 9:36761559-36761581 GAGGCCAGGGAGGAGAGGGCGGG + Intergenic
1053660568 9:40273689-40273711 CAGGCCAAAGTGCAGTGGTGTGG - Intronic
1054524043 9:66102595-66102617 CAGGCCAAAGTGCAGTGGTGTGG + Intergenic
1056390284 9:86134793-86134815 CGGGCCAATGACCTGAGGTCAGG + Intergenic
1056391327 9:86144255-86144277 CAGGCGAATCACCAGAGGTCAGG - Intergenic
1057373346 9:94494702-94494724 CAGGCAGATCAGCAGAGGTCAGG - Intergenic
1057758873 9:97857122-97857144 CTGTCCCAGGTGCAGAGGTCAGG + Intergenic
1058002863 9:99884166-99884188 CTGGCCAAAGAACAGAGGCCTGG + Intergenic
1058717996 9:107739550-107739572 CAGGCCTTTGAGCAGAGGACTGG + Intergenic
1058718007 9:107739620-107739642 CTGGACAAGGAGCGGAGCTCCGG - Intergenic
1060215525 9:121736388-121736410 CAGGCCCTGGAGCAGGGGTTCGG - Intronic
1060215709 9:121737169-121737191 CAGGCCAGAGCACAGAGGTCTGG - Intronic
1060839324 9:126781715-126781737 GAGGCCAGGGAGCGGAGGTCGGG + Intergenic
1061034034 9:128103571-128103593 CAGGCCAGGGACCACAGGACAGG - Intronic
1061140368 9:128762701-128762723 CAGGCCGGGGAGCACAGGCCCGG - Intronic
1061374466 9:130215797-130215819 CAGGGAAAGGTGCAGAGGGCTGG + Intronic
1061480681 9:130896432-130896454 CCGGGCAAGGAGCAGAGGCTGGG - Intergenic
1061505709 9:131030797-131030819 CTGGACAAGGAGCTGAGGCCTGG - Intronic
1061899124 9:133664010-133664032 GAGACCTAGGAGCAGAGGTGGGG + Exonic
1061926436 9:133808256-133808278 CTGGCCAAGGACCAGAGGGTGGG + Intronic
1062215779 9:135389122-135389144 CTGGGGAAGGAGCAGTGGTCAGG + Intergenic
1062556670 9:137115944-137115966 GAGCCAAAGGAGCAGAGGTGTGG - Intergenic
1062589040 9:137264882-137264904 CAGGCCCAGGGGCTGGGGTCTGG + Intronic
1185983834 X:4808363-4808385 CAGGCCACAGACCAGAGGGCTGG + Intergenic
1188644372 X:32546356-32546378 CAAGCAAAGGAGCAGGGATCTGG + Intronic
1189489166 X:41456315-41456337 CAGGAAAAGGAGGAGAGGCCAGG + Intronic
1189726267 X:43970385-43970407 CTGGCCAAGAAGCTGAGGGCTGG + Intronic
1190122324 X:47672371-47672393 CAGGTCAAGGAGCCAAGGCCTGG + Intergenic
1190430378 X:50372853-50372875 CATGCCAGGGAGTAGAGGTGAGG - Intronic
1192222817 X:69208960-69208982 GAGGGCAAGGAGCAGAGGTGAGG - Intergenic
1192528221 X:71866376-71866398 CAGAGCAAGGAGCAGAAGGCTGG - Intergenic
1193539473 X:82753794-82753816 CAGGCCAATCACCTGAGGTCGGG - Intergenic
1195941529 X:110171840-110171862 CAGGCCAAGGGGCAGGGTTAGGG - Intronic
1196531704 X:116795189-116795211 CAGGCCAATCACCTGAGGTCAGG - Intergenic
1196786882 X:119428693-119428715 CAGGCCACGGACCAGGGGTTGGG - Intronic
1197383290 X:125771634-125771656 CAAGCCAAGGAACAAATGTCAGG - Intergenic
1200040027 X:153358325-153358347 GAGGCCAAGGTGTTGAGGTCAGG + Intronic
1200150355 X:153948324-153948346 CAGGCAAAAGGGCAGAGGGCAGG + Exonic
1200737228 Y:6813000-6813022 CAGGCCAATGAGTGGAGCTCAGG - Intergenic
1201256658 Y:12114189-12114211 CAAGCCAAGGAGCAGGTCTCAGG + Intergenic