ID: 1138252481

View in Genome Browser
Species Human (GRCh38)
Location 16:55512770-55512792
Sequence GCCAAGGCCCCCTTAATTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 78}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138252481_1138252487 25 Left 1138252481 16:55512770-55512792 CCACCAATTAAGGGGGCCTTGGC 0: 1
1: 0
2: 1
3: 9
4: 78
Right 1138252487 16:55512818-55512840 CCTCACAAAGGTGATACCATAGG 0: 1
1: 1
2: 1
3: 6
4: 81
1138252481_1138252485 13 Left 1138252481 16:55512770-55512792 CCACCAATTAAGGGGGCCTTGGC 0: 1
1: 0
2: 1
3: 9
4: 78
Right 1138252485 16:55512806-55512828 TTTACACTGAAACCTCACAAAGG 0: 1
1: 0
2: 2
3: 13
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138252481 Original CRISPR GCCAAGGCCCCCTTAATTGG TGG (reversed) Intronic
900346005 1:2210546-2210568 CCCAAGGCCCCCTTACCTGGGGG - Intronic
900607927 1:3531996-3532018 GCCCAGGGCCCCATACTTGGAGG + Intronic
904004409 1:27356372-27356394 GCCAAGGCCCACTCACTTGGAGG + Exonic
904012827 1:27399531-27399553 GACGTGGCCCCCTGAATTGGGGG + Intergenic
904618813 1:31763674-31763696 GCCGAGGCCCCCTTAATCGCTGG - Intronic
905889989 1:41512946-41512968 GCCAAGGCCCACTTCCCTGGCGG + Exonic
906966699 1:50464398-50464420 CCCAAGGCCCCCCTAATAGTTGG + Intronic
912488714 1:110049302-110049324 GCCAAGGCCCCCGTTCTTGTGGG - Intronic
916076306 1:161201776-161201798 GCCAAGGCCGCCGGCATTGGTGG - Intronic
1062837402 10:644725-644747 GCCCAGGCTCCCTGAAGTGGGGG - Intronic
1064099620 10:12451991-12452013 GCCAATAGCCCCTTAATTGAGGG + Intronic
1064434494 10:15299389-15299411 GCCAAGGCAACCTAAACTGGTGG + Intronic
1069459538 10:68581590-68581612 GCCACGGCCTCCTAAAGTGGTGG - Intronic
1075391159 10:122093273-122093295 GCCAGGGCTTCCTTAATGGGAGG - Intronic
1077720740 11:4625997-4626019 GGCAAGGCCCCTTTAATGGGCGG + Intergenic
1077992223 11:7422325-7422347 GCCTAGGACCCCCTAATTTGCGG + Intronic
1080178231 11:29392938-29392960 ACCAAGGCCATCTTAATTGTTGG - Intergenic
1080725912 11:34899568-34899590 GGCAAGGCCCCTTTAATGGAGGG - Intronic
1080916587 11:36666508-36666530 GGCAAGGCCCCTTTAATGGGGGG - Intergenic
1082121508 11:48384505-48384527 GGCAAGGCCCCTTTAATGGAGGG + Intergenic
1082252352 11:49996118-49996140 GGCAAGGCCCCTTTAATGGAGGG - Intergenic
1083617792 11:64035215-64035237 GGCACTGCCCCCTTAATAGGTGG + Intronic
1083627197 11:64077857-64077879 GCCCAGGGCCCCCTGATTGGTGG + Intronic
1085079073 11:73619183-73619205 GCCCAGAACCCCTTAAATGGAGG + Intergenic
1088205610 11:107388627-107388649 GCCTAGGCCCCCCAAATTGCTGG + Intronic
1089884475 11:121806369-121806391 GCCCAGGACCCCTTCCTTGGAGG - Intergenic
1092003650 12:5050988-5051010 GCCAATCCTGCCTTAATTGGAGG - Intergenic
1099365727 12:81763950-81763972 ACCAAGGACCCCTTGAATGGAGG + Intergenic
1102700995 12:114839455-114839477 GCCTTGGCCCCCTTAAGTGCTGG + Intergenic
1102806186 12:115782838-115782860 GCTCAGGCCCCCTGAAATGGGGG - Intergenic
1103965877 12:124639068-124639090 ACCTGGGCCCCCTTACTTGGAGG - Intergenic
1109059366 13:57594207-57594229 GCCTTGGCCCCCTTAAGTGCTGG + Intergenic
1113294642 13:108945351-108945373 GCCAGGGACCACTTATTTGGAGG + Intronic
1116835077 14:49762591-49762613 GCCTAGGCCTCCTAAATTGCTGG + Intergenic
1121846993 14:97180629-97180651 ACCCAGGCCCCCCTCATTGGAGG - Intergenic
1128715046 15:69901582-69901604 GCCAAGGCCTCCTTTCCTGGTGG - Intergenic
1129379214 15:75154859-75154881 GCCAGTGCCCCCTTAAATTGTGG + Intergenic
1129888060 15:79052525-79052547 GCCAAGTGCCCCTTCCTTGGAGG + Intronic
1133689139 16:8196192-8196214 GCCTAGGCCTCCTAAATTGCTGG + Intergenic
1138007958 16:53355191-53355213 GCCAAGGCCACCTTCCCTGGTGG + Intergenic
1138252481 16:55512770-55512792 GCCAAGGCCCCCTTAATTGGTGG - Intronic
1141552120 16:84813194-84813216 GCCGAGCCCCCCTTCCTTGGGGG + Intergenic
1142638641 17:1272266-1272288 GCCAGGGCCCCCATAATGAGGGG + Intergenic
1142839104 17:2613366-2613388 GCCGTGGCCCCCTTCATAGGGGG + Intronic
1148722874 17:49767225-49767247 GCCAAGGCTTCCTTCATTGGAGG - Intronic
1150926911 17:69541901-69541923 TCCAAGGCCCCCTTAAGAGGGGG - Exonic
1159105735 18:64000664-64000686 GCCAAGACCTCCTTATTAGGGGG + Intronic
1161388591 19:4009624-4009646 GTCCAGGCCCCCTTGAATGGAGG - Intronic
1161477806 19:4496087-4496109 GCCCAGGCCCCATTCAGTGGAGG - Intronic
1162970107 19:14175799-14175821 GCCTTGGCCCCCTTAAGTGCTGG - Intronic
1163328166 19:16618618-16618640 GCCAAGGCCCAACTATTTGGCGG + Intronic
926124632 2:10264637-10264659 GTCAAGGCCCCATTCATTCGAGG - Intergenic
930553167 2:52861364-52861386 GCTAAAGGACCCTTAATTGGAGG - Intergenic
932280430 2:70486709-70486731 GCCATGGCCCCCTAAAGTGCTGG + Intronic
943795456 2:191987219-191987241 GCCAATGTCCCCTGAATGGGAGG + Intronic
943984701 2:194604416-194604438 GGCAAGGCTCCTTTAATAGGGGG - Intergenic
944465992 2:200000078-200000100 GCCAAGACCCCCTTGCCTGGAGG + Intronic
1172154053 20:32811148-32811170 GCCAAGGACCCCTCATCTGGAGG - Intergenic
1172723679 20:37019156-37019178 GCCTTGGCCTCCTTAACTGGTGG + Intronic
1172977588 20:38918508-38918530 GGCAAGGCCCCCTTGATCGGAGG + Exonic
1174199925 20:48799935-48799957 CCCAAGGCCCCCTTTATGGCAGG - Intronic
1175392187 20:58634511-58634533 GACAAGGCCCCAGTAAATGGGGG - Intergenic
1177626947 21:23674105-23674127 GCCACGGCCTCCCTAATTGCTGG + Intergenic
949414089 3:3798600-3798622 GCCTTGGCACCCTTTATTGGGGG - Intronic
951216415 3:20029590-20029612 GCCTAGGCCTCCTAAATTGCTGG + Intergenic
966320799 3:178699302-178699324 GCCAAGGCTCCCTGCAATGGTGG + Intronic
968680515 4:1915718-1915740 GCCATTGACCACTTAATTGGGGG + Intronic
975187939 4:71425238-71425260 GCCAAGGAACCCTTTATTGTTGG + Intronic
982908090 4:161102825-161102847 GCCAAGGCCTCCTAAAGTGCTGG + Intergenic
991692431 5:69237854-69237876 GCCTAGGCCTCCCTAATTGCTGG + Intronic
993255995 5:85590839-85590861 GTCAAGGCCCACTTATTTAGAGG + Intergenic
998082953 5:139292209-139292231 GCCAAGGCCTCCAAAAGTGGTGG + Intronic
1001253574 5:170167016-170167038 GCAAAGGCCTCATTAAATGGTGG + Intergenic
1004898916 6:20176167-20176189 GCCTAGGCCTCCTTAGTAGGTGG - Intronic
1006624263 6:35386111-35386133 GCCAAGGGCCTCTTAGATGGCGG + Intronic
1010367644 6:75070557-75070579 GACAATGCCCCTTTAAATGGAGG - Intergenic
1011516009 6:88154503-88154525 GCCAAGGCACTCTTAATTGGAGG - Intronic
1017565018 6:155674593-155674615 GCGAAGTCCCCATTACTTGGTGG - Intergenic
1020074416 7:5248410-5248432 GCCAAGGCCCGCCTGAGTGGTGG + Intergenic
1021061295 7:16116413-16116435 GCCTAGGCCTCCTAAATTGCTGG - Intronic
1039860168 8:41450362-41450384 GCCAAGGCCTCCCAAATTGCTGG + Intergenic
1040397466 8:47013266-47013288 GCCAAGGCCCCTTTAATGGAGGG + Intergenic
1040526093 8:48226479-48226501 GGCAAGGCCCCTTTAATGGAGGG - Intergenic
1048601649 8:135924573-135924595 GCAAAGGCAGCCTTGATTGGTGG - Intergenic
1058007297 9:99930769-99930791 TCCAAGGTACCCTTAATTAGAGG - Intronic
1059002264 9:110360885-110360907 GCCCAGGCCGCCTTGAATGGTGG + Intergenic
1202630132 M:9533-9555 GCCAGTGCCCTCCTAATTGGGGG - Intergenic
1190002759 X:46705445-46705467 GCCAAGATCTTCTTAATTGGAGG - Intronic
1192197545 X:69038546-69038568 GCCAAGGCCACCATAATTCTGGG + Intergenic