ID: 1138255834

View in Genome Browser
Species Human (GRCh38)
Location 16:55559137-55559159
Sequence TATGATGCACATAATGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138255834_1138255836 5 Left 1138255834 16:55559137-55559159 CCAACACCATTATGTGCATCATA 0: 1
1: 0
2: 1
3: 6
4: 133
Right 1138255836 16:55559165-55559187 TTCCTTAGTAAAATTTAGATAGG 0: 1
1: 0
2: 3
3: 18
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138255834 Original CRISPR TATGATGCACATAATGGTGT TGG (reversed) Intronic
901127063 1:6937047-6937069 TATGATGGTGATAATGGTGACGG - Intronic
901300863 1:8199297-8199319 TCTCATGCATATAAAGGTGTTGG + Intergenic
902957076 1:19932960-19932982 TATGATGGTGATAATGGTGATGG - Intergenic
906713972 1:47953215-47953237 GATGATGCACAGAGGGGTGTGGG + Intronic
907126412 1:52055005-52055027 TCTGATGGACATAATGGGCTTGG - Exonic
908103545 1:60815861-60815883 TCTGAAGCACAGAATGGTTTAGG - Intergenic
908843852 1:68304857-68304879 TAGGATGAAGATAATGGTGGAGG - Intergenic
909896156 1:81071860-81071882 GCTGATGCAAATAATTGTGTAGG - Intergenic
916206183 1:162318449-162318471 TGTGAAGCACTTAATGCTGTGGG + Intronic
916312102 1:163409079-163409101 TATCATGCAGATGATGGTGGTGG + Intergenic
918624701 1:186644062-186644084 TATGAAGCAAAGAATGGTTTTGG - Intergenic
919235953 1:194842838-194842860 AATAATGCACATTTTGGTGTTGG + Intergenic
919274633 1:195397737-195397759 TAGGATGCAGAAAATTGTGTGGG + Intergenic
920945813 1:210527510-210527532 TATGATGCTGATAATGGTGATGG - Intronic
923303574 1:232666612-232666634 TATCATGTACACAAGGGTGTTGG - Intergenic
924940394 1:248809360-248809382 TTTGATGCACATAATGAAATAGG - Intergenic
1063248158 10:4245396-4245418 AATGATGAATATAATTGTGTTGG - Intergenic
1065332006 10:24611894-24611916 TATGATGAACATAAATGTGGAGG + Intronic
1068247988 10:54397647-54397669 TTTGATGCACACAATGTTGTTGG - Intronic
1071064564 10:81614986-81615008 TATGTTGCACTTATTGGTGGGGG - Intergenic
1074382691 10:112993151-112993173 TCTGATTCACAAAATGGAGTGGG - Intronic
1075448194 10:122528461-122528483 GAGGATGAACATAATGGTGAGGG - Intergenic
1079109284 11:17595271-17595293 TATGATGTACATGGGGGTGTGGG - Intronic
1080709464 11:34733296-34733318 TATGTTGCACATAATTGAATTGG - Intergenic
1083375699 11:62218587-62218609 TATTATCCACATACTGGAGTAGG - Intergenic
1086938841 11:92774061-92774083 TTTGATGCAGAGAAGGGTGTTGG + Exonic
1087686996 11:101276140-101276162 TATGATGTACCTAAGGATGTTGG + Intergenic
1089751118 11:120651884-120651906 TATGATGATCATAATAATGTTGG - Intronic
1092266771 12:6987294-6987316 TATGAAGCACGTAATTGGGTAGG + Intronic
1095198682 12:39356191-39356213 AATGATGCCCATGCTGGTGTAGG - Intronic
1099570750 12:84314977-84314999 TTTCATGCACATAATGCTGCAGG + Intergenic
1099904411 12:88755340-88755362 TAGGATGCACACAATTCTGTGGG + Intergenic
1100144707 12:91663614-91663636 TATGGTGTACATAAAGATGTAGG - Intergenic
1101744573 12:107529118-107529140 TATGATGGAGATGATGGTGATGG + Intronic
1104183094 12:126401251-126401273 TATGGTGGAAATAATGGTGGTGG + Intergenic
1104869362 12:131983573-131983595 TTTGATGCACATCAGGGCGTGGG + Intronic
1109453585 13:62551845-62551867 TAGGATTCCCATAATGGGGTGGG + Intergenic
1109688484 13:65852557-65852579 AATGATACACATAATTGTGCAGG - Intergenic
1111412230 13:87892114-87892136 AGTGATGCTCATCATGGTGTGGG - Intergenic
1115421532 14:33200507-33200529 TATGGGGCACATAAAGGTATGGG - Intronic
1115930330 14:38484032-38484054 TTTGCTGCATATAATGGTCTAGG - Intergenic
1118231315 14:63952986-63953008 TATGAAGCACAGAATAGTGATGG + Intronic
1122304811 14:100757232-100757254 TATTAGGCACATAAAGGTTTAGG - Intergenic
1124125395 15:26934538-26934560 TATAATGGACATAACCGTGTGGG - Intronic
1125529641 15:40404452-40404474 TATGTTGCACAGGATGGTCTTGG + Intergenic
1138255834 16:55559137-55559159 TATGATGCACATAATGGTGTTGG - Intronic
1141726529 16:85792871-85792893 CAAGATGCACATCAGGGTGTGGG - Intronic
1145726589 17:27132148-27132170 TTTGATGCACACAATGTTGTTGG - Intergenic
1146416292 17:32636308-32636330 GATGATGCTAATAATAGTGTTGG - Intronic
1148684266 17:49492005-49492027 GATGATGGTCATAATGGTGCTGG + Intergenic
1149206727 17:54256423-54256445 TATTATGCTCACAATGTTGTTGG + Intergenic
1158716707 18:59887023-59887045 TTTGATGCAGATAATGAGGTAGG + Intergenic
1158814500 18:61078555-61078577 TATTATGCACATCATGCAGTGGG - Intergenic
1163387758 19:17010439-17010461 TATGTTGCCCAGAATGGTCTCGG + Intronic
1164598465 19:29545784-29545806 TATGATGAACATACAGGTGCAGG + Intronic
925505469 2:4557959-4557981 TATGATGGACATGTTGGTATAGG - Intergenic
925517061 2:4694590-4694612 AATGATGTGCAGAATGGTGTTGG - Intergenic
925552670 2:5093252-5093274 TATGAGTCACATAATGGTACAGG + Intergenic
930591428 2:53331304-53331326 TTTTATGCACAGAATGGTGCTGG - Intergenic
931627864 2:64272958-64272980 TAGGATGCACAAAAAAGTGTGGG + Intergenic
931658281 2:64530383-64530405 TATGATGTAGATAATGATTTGGG - Intronic
933799432 2:85949061-85949083 TATGTTGGACATGATGGTGACGG - Intergenic
934150058 2:89137586-89137608 TTTTATGCTCATAATGGTGAAGG + Intergenic
934217238 2:90044442-90044464 TTTTATGCTCATAATGGTGAAGG - Intergenic
935832145 2:107011363-107011385 AATGATGCACACAATGATGATGG + Intergenic
936156874 2:110052728-110052750 GATGATGAAGATAATGGTGATGG + Intergenic
936187820 2:110318716-110318738 GATGATGAAGATAATGGTGATGG - Intergenic
938837828 2:135125697-135125719 GATGATTCACCTAATGGGGTGGG + Intronic
941176208 2:162199956-162199978 TATGAAGCAGGTAATGTTGTTGG - Intronic
942251515 2:174051312-174051334 TATGCTGCACACAATACTGTAGG + Intergenic
942701913 2:178720956-178720978 TGTGAGGCTCATAATGGTGTTGG - Exonic
943003796 2:182363701-182363723 CATGATGCAGAAAATGGTATTGG - Intronic
944225319 2:197343720-197343742 TAAGATGAAGATAAAGGTGTCGG + Intergenic
946163449 2:217849587-217849609 AATGATACTCATAATGGTGATGG - Intronic
946668622 2:222077777-222077799 GATGATGATTATAATGGTGTGGG + Intergenic
947606032 2:231486228-231486250 TAGAATGAACATTATGGTGTTGG + Intergenic
1169470549 20:5881596-5881618 AATGATGCAGGTGATGGTGTTGG - Intergenic
1173650994 20:44664092-44664114 CATGACGCAGATAATGGGGTGGG + Intergenic
1175533034 20:59687267-59687289 GATGATGATCATAGTGGTGTTGG + Intronic
1178372406 21:32037398-32037420 TATGATGGAGATAATGTTGGTGG - Intronic
1180930625 22:19588235-19588257 TATAATTCACTTAATGGTGATGG + Intergenic
1181010361 22:20036788-20036810 GATGATGCACATGGTGGTGCAGG - Exonic
1184790126 22:46695053-46695075 TATGATGCCCATGATGGCCTAGG - Intronic
1185176132 22:49328047-49328069 TATGATGCTCTTAAGGGTTTTGG + Intergenic
949392237 3:3575338-3575360 TGTGCTATACATAATGGTGTGGG + Intergenic
949771947 3:7588565-7588587 TCTCATGTACATGATGGTGTTGG + Intronic
951732052 3:25820920-25820942 TCAGATGCACATATTTGTGTGGG - Intergenic
952346595 3:32493561-32493583 TAAGATGCAGATAAAGATGTGGG + Intronic
955102515 3:55864919-55864941 AATGATGGTGATAATGGTGTTGG - Intronic
959930287 3:111974019-111974041 TATTCTGGACATAATGGTTTGGG + Intronic
965516012 3:169621879-169621901 AATGATGCAGGTAATGGTGAGGG - Intronic
966642832 3:182209725-182209747 TAAGATGTTAATAATGGTGTGGG - Intergenic
966996794 3:185290193-185290215 TATAATGCCAATAATGGTGATGG + Intronic
967269099 3:187718312-187718334 TATGAAGCTTATAATTGTGTGGG - Intronic
969025353 4:4168252-4168274 TCTGATGCACACAATGGAGAAGG + Intergenic
972289107 4:37674652-37674674 GATAATTCACATAATTGTGTTGG + Intronic
975253092 4:72202110-72202132 CATAATGCACCTAATTGTGTAGG - Intergenic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
979351271 4:119646804-119646826 TATTATGCTCACAATTGTGTGGG - Intergenic
981243807 4:142510031-142510053 TATCATAAAAATAATGGTGTTGG - Intronic
981918983 4:150066463-150066485 TATGCTACACATAAAGGTGCTGG + Intergenic
982299259 4:153862176-153862198 GTTTATGCACATAAAGGTGTTGG + Intergenic
985294892 4:188426078-188426100 TATGATGTTGATAATGGTGGTGG - Intergenic
986726145 5:10598639-10598661 TATGTTGCACAGACTGGTCTTGG + Intronic
990325865 5:54674819-54674841 TATAGTGCACATCATGGTGGGGG + Intergenic
991096619 5:62746617-62746639 TCTGAAGCACATAAAGGTGGTGG - Intergenic
992979205 5:82150075-82150097 TATGATACACCTATTGCTGTGGG + Intronic
994812546 5:104540119-104540141 TAGGATGCACAGAATGGAATAGG - Intergenic
995857927 5:116613492-116613514 TATTATGGGCATAAAGGTGTAGG + Intergenic
996914407 5:128694993-128695015 TATGTTGAATATAATGGTTTTGG - Intronic
1000111738 5:158114594-158114616 TATGAGACACATAATGCTTTTGG + Intergenic
1000117913 5:158170754-158170776 GATGATGCATATAAAGCTGTTGG + Intergenic
1009029789 6:58042976-58042998 TATTATGCACGTATTGCTGTTGG + Intergenic
1012362641 6:98402710-98402732 GATGATACAGATAATGGAGTTGG - Intergenic
1014545560 6:122731292-122731314 TATGATAAATATACTGGTGTAGG - Intergenic
1019288870 7:237487-237509 GATGATGGAGATAATGGTGATGG + Intronic
1020412107 7:7903754-7903776 GATGATGCACATATGAGTGTTGG - Intronic
1021147123 7:17102678-17102700 TTTGATACACAAAATGGTCTAGG - Intergenic
1024403912 7:48955322-48955344 TATGAAGCACATACTCATGTAGG - Intergenic
1028021198 7:85775965-85775987 TATGATGAAAATAATATTGTGGG - Intergenic
1029885765 7:103869523-103869545 TATGATGCATATAGTGTTCTGGG + Intronic
1030656686 7:112176088-112176110 AATGATTGAAATAATGGTGTTGG - Intronic
1031606875 7:123779519-123779541 TATAATGAAAATAATGGTGATGG + Intergenic
1031767657 7:125801966-125801988 TATTATGCACATATTGCTTTTGG - Intergenic
1033865388 7:145685475-145685497 TAAGATCCAGATAATGGTTTTGG - Intergenic
1035659670 8:1337539-1337561 GATGATGATCATAATGGTGGTGG + Intergenic
1041911691 8:63095728-63095750 TATGACCCACCCAATGGTGTTGG - Intergenic
1043045639 8:75320433-75320455 TATTATGCACATAAAGTTTTGGG - Intergenic
1045963622 8:107998551-107998573 CATGATGCTTATAATGGTGATGG - Intronic
1050832957 9:10037090-10037112 TATGTTGCCCAGAATGGTCTCGG + Intronic
1052755218 9:32534004-32534026 TATGACGCAGATACTGGTTTTGG + Intergenic
1185759446 X:2678897-2678919 AATGATGCACATATTGTTGTTGG + Intergenic
1186702381 X:12105869-12105891 TATGATGCAAATAATGGAGTAGG - Intergenic
1189214999 X:39315331-39315353 ATTGATGCCCACAATGGTGTTGG - Intergenic
1189803513 X:44713491-44713513 AATGATGCAAATATTGATGTAGG - Intergenic
1190014402 X:46814374-46814396 TATGTTGCCCATACTGGTCTGGG - Intergenic
1191940624 X:66476926-66476948 TATGACCCAAATAATGGTCTAGG + Intergenic
1195712371 X:107783955-107783977 AATGAAGCACAGAATGGTGATGG + Intronic
1196136323 X:112213229-112213251 TAGGAGTCACATAATGTTGTTGG + Intergenic
1196596665 X:117553767-117553789 TATGCTGCACAGAATGGTGGAGG + Intergenic
1197109250 X:122753810-122753832 TATTATGTACAAAATGGTCTTGG + Intergenic