ID: 1138263367

View in Genome Browser
Species Human (GRCh38)
Location 16:55641648-55641670
Sequence GGCCATAACAGCTGTACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138263367_1138263374 9 Left 1138263367 16:55641648-55641670 CCTGCAGTACAGCTGTTATGGCC No data
Right 1138263374 16:55641680-55641702 GGTGTGCACACCTGTAAAAGGGG No data
1138263367_1138263377 20 Left 1138263367 16:55641648-55641670 CCTGCAGTACAGCTGTTATGGCC No data
Right 1138263377 16:55641691-55641713 CTGTAAAAGGGGAAGATACTGGG No data
1138263367_1138263372 7 Left 1138263367 16:55641648-55641670 CCTGCAGTACAGCTGTTATGGCC No data
Right 1138263372 16:55641678-55641700 TTGGTGTGCACACCTGTAAAAGG No data
1138263367_1138263373 8 Left 1138263367 16:55641648-55641670 CCTGCAGTACAGCTGTTATGGCC No data
Right 1138263373 16:55641679-55641701 TGGTGTGCACACCTGTAAAAGGG No data
1138263367_1138263376 19 Left 1138263367 16:55641648-55641670 CCTGCAGTACAGCTGTTATGGCC No data
Right 1138263376 16:55641690-55641712 CCTGTAAAAGGGGAAGATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138263367 Original CRISPR GGCCATAACAGCTGTACTGC AGG (reversed) Intergenic
No off target data available for this crispr