ID: 1138263370

View in Genome Browser
Species Human (GRCh38)
Location 16:55641670-55641692
Sequence AGGTGTGCACACCAAGGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138263370_1138263376 -3 Left 1138263370 16:55641670-55641692 CCTTGACCTTGGTGTGCACACCT No data
Right 1138263376 16:55641690-55641712 CCTGTAAAAGGGGAAGATACTGG No data
1138263370_1138263378 26 Left 1138263370 16:55641670-55641692 CCTTGACCTTGGTGTGCACACCT No data
Right 1138263378 16:55641719-55641741 AGCCAATGTTTCCTGAATTCTGG No data
1138263370_1138263377 -2 Left 1138263370 16:55641670-55641692 CCTTGACCTTGGTGTGCACACCT No data
Right 1138263377 16:55641691-55641713 CTGTAAAAGGGGAAGATACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138263370 Original CRISPR AGGTGTGCACACCAAGGTCA AGG (reversed) Intergenic
No off target data available for this crispr