ID: 1138263372

View in Genome Browser
Species Human (GRCh38)
Location 16:55641678-55641700
Sequence TTGGTGTGCACACCTGTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138263367_1138263372 7 Left 1138263367 16:55641648-55641670 CCTGCAGTACAGCTGTTATGGCC No data
Right 1138263372 16:55641678-55641700 TTGGTGTGCACACCTGTAAAAGG No data
1138263365_1138263372 26 Left 1138263365 16:55641629-55641651 CCGTGAACATGCAGACTGACCTG No data
Right 1138263372 16:55641678-55641700 TTGGTGTGCACACCTGTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138263372 Original CRISPR TTGGTGTGCACACCTGTAAA AGG Intergenic
No off target data available for this crispr