ID: 1138263376

View in Genome Browser
Species Human (GRCh38)
Location 16:55641690-55641712
Sequence CCTGTAAAAGGGGAAGATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138263370_1138263376 -3 Left 1138263370 16:55641670-55641692 CCTTGACCTTGGTGTGCACACCT No data
Right 1138263376 16:55641690-55641712 CCTGTAAAAGGGGAAGATACTGG No data
1138263371_1138263376 -9 Left 1138263371 16:55641676-55641698 CCTTGGTGTGCACACCTGTAAAA No data
Right 1138263376 16:55641690-55641712 CCTGTAAAAGGGGAAGATACTGG No data
1138263367_1138263376 19 Left 1138263367 16:55641648-55641670 CCTGCAGTACAGCTGTTATGGCC No data
Right 1138263376 16:55641690-55641712 CCTGTAAAAGGGGAAGATACTGG No data
1138263369_1138263376 -2 Left 1138263369 16:55641669-55641691 CCCTTGACCTTGGTGTGCACACC No data
Right 1138263376 16:55641690-55641712 CCTGTAAAAGGGGAAGATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138263376 Original CRISPR CCTGTAAAAGGGGAAGATAC TGG Intergenic
No off target data available for this crispr