ID: 1138263378

View in Genome Browser
Species Human (GRCh38)
Location 16:55641719-55641741
Sequence AGCCAATGTTTCCTGAATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138263375_1138263378 6 Left 1138263375 16:55641690-55641712 CCTGTAAAAGGGGAAGATACTGG No data
Right 1138263378 16:55641719-55641741 AGCCAATGTTTCCTGAATTCTGG No data
1138263369_1138263378 27 Left 1138263369 16:55641669-55641691 CCCTTGACCTTGGTGTGCACACC No data
Right 1138263378 16:55641719-55641741 AGCCAATGTTTCCTGAATTCTGG No data
1138263371_1138263378 20 Left 1138263371 16:55641676-55641698 CCTTGGTGTGCACACCTGTAAAA No data
Right 1138263378 16:55641719-55641741 AGCCAATGTTTCCTGAATTCTGG No data
1138263370_1138263378 26 Left 1138263370 16:55641670-55641692 CCTTGACCTTGGTGTGCACACCT No data
Right 1138263378 16:55641719-55641741 AGCCAATGTTTCCTGAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138263378 Original CRISPR AGCCAATGTTTCCTGAATTC TGG Intergenic
No off target data available for this crispr