ID: 1138264531

View in Genome Browser
Species Human (GRCh38)
Location 16:55651058-55651080
Sequence CAGGGACACCACCATGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138264520_1138264531 29 Left 1138264520 16:55651006-55651028 CCCATTCGGAGGCTATGACATTA No data
Right 1138264531 16:55651058-55651080 CAGGGACACCACCATGAGGTGGG No data
1138264525_1138264531 4 Left 1138264525 16:55651031-55651053 CCAGGCAAGAGGTGACATGGCTT No data
Right 1138264531 16:55651058-55651080 CAGGGACACCACCATGAGGTGGG No data
1138264521_1138264531 28 Left 1138264521 16:55651007-55651029 CCATTCGGAGGCTATGACATTAA No data
Right 1138264531 16:55651058-55651080 CAGGGACACCACCATGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138264531 Original CRISPR CAGGGACACCACCATGAGGT GGG Intergenic
No off target data available for this crispr