ID: 1138264692

View in Genome Browser
Species Human (GRCh38)
Location 16:55652115-55652137
Sequence TCTCCTCATTGGTGCCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138264687_1138264692 -5 Left 1138264687 16:55652097-55652119 CCTCCTTTTTTTCCTTAGTCTCC No data
Right 1138264692 16:55652115-55652137 TCTCCTCATTGGTGCCATGGAGG No data
1138264688_1138264692 -8 Left 1138264688 16:55652100-55652122 CCTTTTTTTCCTTAGTCTCCTCA No data
Right 1138264692 16:55652115-55652137 TCTCCTCATTGGTGCCATGGAGG No data
1138264686_1138264692 0 Left 1138264686 16:55652092-55652114 CCTCTCCTCCTTTTTTTCCTTAG No data
Right 1138264692 16:55652115-55652137 TCTCCTCATTGGTGCCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138264692 Original CRISPR TCTCCTCATTGGTGCCATGG AGG Intergenic
No off target data available for this crispr