ID: 1138265357

View in Genome Browser
Species Human (GRCh38)
Location 16:55656288-55656310
Sequence CTGTGGCTGTTGAAGTGTCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138265357 Original CRISPR CTGTGGCTGTTGAAGTGTCG CGG Intronic
901485563 1:9558346-9558368 CTCTGGCTGTTGGAGGGTCCAGG + Intronic
905357561 1:37395369-37395391 CTGTGGCTGGTGAGGTGGAGGGG - Intergenic
907433525 1:54429099-54429121 CTGTGGCTGTTGTCATGTCTGGG + Intergenic
912638361 1:111320116-111320138 CTGTGGGAGTGGAAGTGTGGAGG - Intronic
915303816 1:154966539-154966561 CTGTGGCTGTAAATGTGTGGTGG + Intronic
918376831 1:183917880-183917902 CTGTGTTTGCTGGAGTGTCGGGG + Intronic
922184249 1:223259916-223259938 CTGTGTATTTTGAAGTGTGGTGG - Intronic
1073641331 10:105255310-105255332 CTGGGCCTGTTGTGGTGTCGGGG + Intronic
1076411552 10:130255092-130255114 CTGTGGCTGTTGAAGGGGCCTGG + Intergenic
1076512710 10:131023810-131023832 CAGTGGCTGTTTAATTGCCGTGG - Intergenic
1076852456 10:133099746-133099768 GTGTGGCTGCTGAAGTGGGGTGG - Intronic
1077159109 11:1104594-1104616 CTGTGGCTGATGGAGGGTCAAGG - Intergenic
1083571907 11:63765578-63765600 CTGTGGTTTTTGAAGTATCAAGG - Intronic
1094031754 12:26020170-26020192 ATGAGGCTGTTGAACTGTGGAGG + Intronic
1094367981 12:29704462-29704484 CTGTGGATGTTGAAGTAACCAGG - Intronic
1095040216 12:37432894-37432916 CCTTGGCTGTTCAAGTGTGGAGG + Intergenic
1096807593 12:54150023-54150045 CTGTGGCTTTCGAAGGGTTGAGG - Intergenic
1096809412 12:54160128-54160150 CTGTGGCTGTTGGGGTGGGGGGG - Intergenic
1099991064 12:89720879-89720901 CTGTGGCTCTTCCAGTGTTGAGG - Intergenic
1100804196 12:98263896-98263918 TTGTGGCTGTTGAAGAGACTCGG - Intergenic
1100837953 12:98585037-98585059 CTAAGGCTGATGAAGTGTCCTGG - Intergenic
1104393266 12:128409117-128409139 TTGCGGCAGTTGAAGTGTCTGGG + Intronic
1110715962 13:78704450-78704472 CTGGGCCTGTTGAAGGGTTGGGG + Intergenic
1110871262 13:80455018-80455040 CTGGGGCCATTGAAGTGTGGAGG + Intergenic
1112311923 13:98325882-98325904 CTGTGGCTGTTGCGGAGTCTTGG - Intronic
1112328124 13:98457395-98457417 CTGGGGCTGGGGTAGTGTCGTGG - Intronic
1115987588 14:39118033-39118055 CTGTTGCCATTGAAGTGTTGGGG - Exonic
1123141751 14:106086766-106086788 CTGTGGCTGCTGCAGTCACGTGG - Intergenic
1123193144 14:106590944-106590966 CTGTGGCTGCTGCAGTCACGCGG - Intergenic
1125332189 15:38593294-38593316 CTGAGGCTTTTGAAGTGTAAAGG + Intergenic
1125525488 15:40371471-40371493 CTGTGGCTGTAGAAGAGGCACGG - Intergenic
1136870633 16:33804364-33804386 CTGTGGCTGCTGCAGTCACGCGG + Intergenic
1138265357 16:55656288-55656310 CTGTGGCTGTTGAAGTGTCGCGG + Intronic
1141886782 16:86897687-86897709 CTGTGGCTGTGGCAGTGACCTGG - Intergenic
1203101539 16_KI270728v1_random:1311694-1311716 CTGTGGCTGCTGCAGTCACGCGG - Intergenic
1144330840 17:14222800-14222822 CTGTGGCTGGAGCAGTGTGGGGG - Intergenic
1144351377 17:14400337-14400359 CTGTGTCTTTTGGAGTGACGAGG + Intergenic
1145377692 17:22366303-22366325 CATTGGCTGTTCAAGTGTGGAGG - Intergenic
1146617068 17:34365223-34365245 CAGTGGCTCTTGAAGTGTTTTGG + Intergenic
1147157546 17:38551877-38551899 CTGTGTCTGTTGAGGTGCTGGGG - Exonic
1147267566 17:39244169-39244191 CTGTGGTTGTTGAAGCTTCCAGG + Intergenic
1147333402 17:39712252-39712274 ATGTGGCTGTTGACCTGTCCCGG + Intronic
1149849905 17:60028204-60028226 CTGTTGCTGGTGAAGTGTTCAGG - Intergenic
1149860263 17:60118320-60118342 CTGTTGCTGGTGAAGTGTTCAGG + Intergenic
1152698139 17:81806379-81806401 CTGTGGATGCTGAGCTGTCGGGG + Intronic
1162751606 19:12833269-12833291 CTGGGGCTGTAGAGGTCTCGTGG + Intronic
1164548852 19:29191086-29191108 CGGTGACTGCTGAAGTCTCGAGG - Intergenic
1164570710 19:29372396-29372418 CTGTAGCTGCTGAAGTGTGAGGG + Intergenic
1165575102 19:36808716-36808738 CCTTGGCTGTTAAAGTGTGGAGG + Intergenic
1165846200 19:38819290-38819312 CTGTGGCTGTTGAAGAGGGAGGG - Intronic
1168200134 19:54809009-54809031 CTTTCGCTGTTGGAGTGTCTGGG - Intronic
926102708 2:10130042-10130064 CTGTGGCTTGTGTAGTGTCCTGG + Exonic
928082011 2:28320026-28320048 CTGTGGGTGCTGCAGTGTTGTGG + Intronic
931590961 2:63882858-63882880 CTGTGGTTGTTGAAATCTCTGGG + Intronic
934894274 2:98100410-98100432 CTGTGGCTGATACAGTGTTGGGG + Intronic
935635907 2:105249757-105249779 CTCTGGCTGTTGAAAGGTGGAGG + Intergenic
939674368 2:145053669-145053691 CTGTAGCTGTAGAAGTTTTGAGG + Intergenic
947501563 2:230674878-230674900 CTGTGGCTGTTGTACCCTCGGGG - Intergenic
1169140912 20:3227120-3227142 CTGTGGCTGGTGAAGAGCAGTGG - Intergenic
1171534781 20:25877578-25877600 CCTTGGCTGTTCAAGTGTGGAGG + Intergenic
1171792246 20:29538010-29538032 CCTTGGCTGTTCAAGTGTAGAGG - Intergenic
1171856110 20:30344937-30344959 CCTTGGCTGTTCAAGTGTAGAGG + Intergenic
1172102713 20:32495179-32495201 CTGTGGCTGAGGAAGTGCCCAGG - Intronic
1175445693 20:59018068-59018090 TTGTGCCTGTTGAGCTGTCGAGG - Intergenic
1176335980 21:5600640-5600662 CTGTGCCTGTTGAAGCCTCTGGG - Intergenic
1176391777 21:6220308-6220330 CTGTGCCTGTTGAAGCCTCTGGG + Intergenic
1176469642 21:7095866-7095888 CTGTGCCTGTTGAAGCCTCTGGG - Intergenic
1176493203 21:7477644-7477666 CTGTGCCTGTTGAAGCCTCTGGG - Intergenic
1176507439 21:7660739-7660761 CTGTGCCTGTTGAAGCCTCTGGG + Intergenic
1182915384 22:34024560-34024582 CTGTGGCTTTTGGAGTCTCTGGG + Intergenic
1183122514 22:35741042-35741064 CTGTGGCTGTTGAAGGATGATGG + Intronic
1184306010 22:43602363-43602385 CTTTGGCTGTTGAAGAGCTGTGG + Intronic
951672398 3:25199598-25199620 CAGTGCCTGTTGTGGTGTCGGGG - Intronic
953352055 3:42223096-42223118 GTGTGGCTGTTGAAGGAGCGGGG + Exonic
953787833 3:45923939-45923961 CTGAGGCTGTTGATGACTCGTGG + Intronic
954854082 3:53627597-53627619 CTGTGGCTGTGGATGGGTGGGGG + Intronic
960571821 3:119191972-119191994 ATGTGGCTGCTGAAGTTTCTAGG - Intronic
962260674 3:133901570-133901592 CTGTGCTTGTTGATGTGTCTGGG + Intergenic
965679287 3:171233857-171233879 CTGTGGCTGGGGAAATGTGGGGG - Intronic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
969574247 4:8027341-8027363 CTGGGGCTGTGGAAGAGTCAGGG + Intronic
973806256 4:54528611-54528633 CTGTGGCTGCTCAGGTGTCCAGG + Intergenic
984899298 4:184570482-184570504 CCTTGGCTGTTCAAGTGTGGAGG - Intergenic
989998258 5:50861294-50861316 CTGTGTCTGTTGATGTTTCCAGG + Intergenic
996559420 5:124812927-124812949 CTGAGGCTGATGACGTGTCATGG + Intergenic
996944612 5:129051446-129051468 CTGTGGCTGATGAAATCTCTTGG - Intergenic
998470551 5:142380553-142380575 CTGGGGCTGGTGAAGTGAGGAGG + Intergenic
998881704 5:146652025-146652047 GTGTGGCTGTAGAAGGGTCAGGG + Intronic
999075983 5:148795995-148796017 CTGTGGTTGTGGAAATGTAGAGG + Intergenic
1007627658 6:43255379-43255401 CTGTGGGTGTTGGAGGGTTGGGG + Intronic
1010028955 6:71252744-71252766 CTGTGGCTGATGAAATCTCCAGG + Intergenic
1016734521 6:147462145-147462167 CTGTGCCTGTTGTGGGGTCGGGG + Intergenic
1016764280 6:147774655-147774677 CTGTGGTTGTAGAAGAGTGGAGG + Intergenic
1018962914 6:168460971-168460993 CTGTGTCTGTAGAAGTGCCCAGG + Intronic
1019318680 7:404901-404923 CATTGTCTGTTGATGTGTCGTGG - Intergenic
1019606686 7:1913594-1913616 CTCTGGCTCTAGAAGTGGCGGGG + Intronic
1020457996 7:8396121-8396143 CTGTGGCAGTTGAAGGTTCAAGG + Intergenic
1023521057 7:41050324-41050346 CTGTGTCAGTTTAGGTGTCGAGG - Intergenic
1028879102 7:95859542-95859564 CTGTGGCTGATGTGGTGTTGGGG + Intronic
1030345754 7:108431279-108431301 CTGTGGCAGTGGAAGTGGCACGG - Intronic
1030508295 7:110452345-110452367 CTGTGTTAGTTGAAGTGTAGGGG - Intergenic
1032086684 7:128887378-128887400 CTGTGGCTGTGTATGTGTGGAGG - Intronic
1032894984 7:136240616-136240638 CTGTGGCTCTTGAGGAGTAGTGG + Intergenic
1035973076 8:4273933-4273955 TGGAGGCTGTTGAAGTGTCCTGG + Intronic
1040556114 8:48478740-48478762 CAGTGGCTGCTGAATTGTCTGGG + Intergenic
1044619753 8:94177239-94177261 CTGTGGCTGTTGCATTGGCTTGG - Intronic
1047349328 8:124058618-124058640 CTGGGGCTCCTGAAGTGTCTTGG - Intronic
1049253513 8:141601917-141601939 CTGTGACTGCTGAACTGCCGTGG + Intergenic
1053793704 9:41705572-41705594 CCTTGGCTGTTCAAGTGTAGAGG + Intergenic
1054151470 9:61609258-61609280 CCTTGGCTGTTCAAGTGTAGAGG - Intergenic
1054182113 9:61917586-61917608 CCTTGGCTGTTCAAGTGTAGAGG + Intergenic
1054471244 9:65540397-65540419 CCTTGGCTGTTCAAGTGTAGAGG - Intergenic
1061686373 9:132283180-132283202 TTGTGGCTGCTGAAATGTTGAGG - Intronic
1203425658 Un_GL000195v1:34262-34284 CTGTGCCTGTTGAAGCCTCTGGG + Intergenic
1187916040 X:24152652-24152674 CTGTGGTTGTTGAGGTGTTAAGG + Intronic
1189038019 X:37512746-37512768 AGGTGGCTGTTCAAGTGTCATGG - Intronic
1189442322 X:41048537-41048559 CTGTGGCTATTGATGTTTCTAGG + Intergenic
1189610461 X:42727946-42727968 CTGGGCCTGTTGGAGTGTGGAGG + Intergenic
1191197467 X:57740526-57740548 CTGTGTCTGTTGAAGCATAGGGG + Intergenic
1192782672 X:74309824-74309846 CTGTGCCTATTGAAGTTTCTGGG - Intergenic
1193633878 X:83924801-83924823 CTGTGTCTGTGGCAGTGTTGGGG + Intergenic
1193773856 X:85619959-85619981 CTCTGCCTGTTGATGTGTAGGGG - Intergenic
1197234154 X:124040230-124040252 CTGTAGCTGTTGAAGCATGGAGG + Intronic
1198496637 X:137199923-137199945 CTGTGACTGTTGAACTCTAGTGG + Intergenic
1200242203 X:154502847-154502869 CAGTTGCTGGAGAAGTGTCGGGG + Intergenic