ID: 1138269625

View in Genome Browser
Species Human (GRCh38)
Location 16:55685843-55685865
Sequence CAACTCCGGACTGGCCCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 147}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138269625_1138269633 27 Left 1138269625 16:55685843-55685865 CCATGAGGGCCAGTCCGGAGTTG 0: 1
1: 0
2: 0
3: 7
4: 147
Right 1138269633 16:55685893-55685915 TCCTATAGTCAGCCTCTCATGGG 0: 1
1: 0
2: 0
3: 6
4: 118
1138269625_1138269629 -8 Left 1138269625 16:55685843-55685865 CCATGAGGGCCAGTCCGGAGTTG 0: 1
1: 0
2: 0
3: 7
4: 147
Right 1138269629 16:55685858-55685880 CGGAGTTGGCATTCTGAACTTGG 0: 1
1: 0
2: 0
3: 14
4: 82
1138269625_1138269630 -7 Left 1138269625 16:55685843-55685865 CCATGAGGGCCAGTCCGGAGTTG 0: 1
1: 0
2: 0
3: 7
4: 147
Right 1138269630 16:55685859-55685881 GGAGTTGGCATTCTGAACTTGGG 0: 1
1: 0
2: 3
3: 16
4: 132
1138269625_1138269635 30 Left 1138269625 16:55685843-55685865 CCATGAGGGCCAGTCCGGAGTTG 0: 1
1: 0
2: 0
3: 7
4: 147
Right 1138269635 16:55685896-55685918 TATAGTCAGCCTCTCATGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 74
1138269625_1138269632 26 Left 1138269625 16:55685843-55685865 CCATGAGGGCCAGTCCGGAGTTG 0: 1
1: 0
2: 0
3: 7
4: 147
Right 1138269632 16:55685892-55685914 CTCCTATAGTCAGCCTCTCATGG 0: 1
1: 0
2: 0
3: 9
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138269625 Original CRISPR CAACTCCGGACTGGCCCTCA TGG (reversed) Intronic
900103910 1:974173-974195 CAACTCCCTACTGGCCCCCCTGG - Intronic
900123109 1:1057888-1057910 CAACACCAGACTGGCCAACATGG + Intergenic
900177252 1:1296343-1296365 CACCCCCGGCCTGGCCCTCAGGG + Intronic
900177274 1:1296396-1296418 CACCCCCAGCCTGGCCCTCAGGG + Intronic
901723980 1:11225620-11225642 CAACTCCAGCCTGGCCAACATGG - Intronic
902248832 1:15140108-15140130 AAAATCCAGGCTGGCCCTCAAGG + Intergenic
902545146 1:17185334-17185356 CAGCTCCGGACAGGCCATCTCGG + Intergenic
903721278 1:25407263-25407285 CAGCTCCTGACTGGCCCTAGAGG - Intronic
903750056 1:25616295-25616317 CAACCCCGGGCTGGCACTCGGGG + Intergenic
904755862 1:32768236-32768258 CAACCCTGAACTAGCCCTCAGGG - Intronic
907035945 1:51216382-51216404 CAACACCAGACTGGCCAACATGG - Intergenic
912506250 1:110158526-110158548 CAACTCAGGCCAGGCCCTCAGGG - Intronic
914404636 1:147358427-147358449 CAACTCCAGACAGGGGCTCAGGG + Intergenic
915064345 1:153212332-153212354 CAAGTCCCGTCTGGCCCTGAGGG + Intergenic
915281767 1:154827596-154827618 CAAGACCGGCCTGGCCATCATGG + Intronic
917092398 1:171366532-171366554 CAACCCCAGCCTGGCCATCATGG - Intergenic
918697297 1:187560333-187560355 CAACTCCAGCCAGGGCCTCAGGG - Intergenic
920009718 1:202859063-202859085 GCACTCCGGCCTGGCCCACATGG + Intergenic
920026460 1:203001519-203001541 CAAGACCGGCCTGGCCATCATGG - Intergenic
921006935 1:211102735-211102757 CAACTCCGGGGTGGTCCTTATGG - Intronic
923837306 1:237626772-237626794 CAACACCAGCCTGGCCATCATGG - Intronic
1066424742 10:35296544-35296566 GCACTCCGGCCTGGGCCTCAGGG + Intronic
1067097935 10:43314703-43314725 CAAGTACGGACTGGTCCTCGAGG + Intergenic
1068910825 10:62376318-62376340 GAACTCCAGATGGGCCCTCAAGG - Exonic
1072005835 10:91245981-91246003 CAACTCTGCACTGGCACCCATGG - Intronic
1072433674 10:95396265-95396287 CAGCTCCTGACTGACTCTCAGGG + Intronic
1075375325 10:121974395-121974417 CAACTGTGGAGTGGCCCTCCAGG - Intronic
1076985182 11:230921-230943 CAAGACCGGCCTGGCCATCATGG + Intronic
1077010705 11:377971-377993 CAACTCCTAACTCGCCTTCAAGG - Intronic
1077394988 11:2316291-2316313 CAGCATCGGCCTGGCCCTCACGG + Exonic
1077419596 11:2444325-2444347 CAACTCCGGAGTGGCTCAGAGGG + Intergenic
1080045166 11:27800551-27800573 TAACTCAGAAGTGGCCCTCAAGG + Intergenic
1083340330 11:61955098-61955120 CACCCCCAGGCTGGCCCTCACGG + Exonic
1083941229 11:65896956-65896978 CAGCTCCTGACTGCCACTCATGG + Exonic
1088383372 11:109221385-109221407 CAACTCCGGCCAGGGGCTCAGGG - Intergenic
1088794598 11:113257118-113257140 GATCTCTGGACTGGGCCTCAGGG - Intronic
1094428301 12:30338731-30338753 CAAGTCCAGACTGGCCAGCATGG + Intergenic
1094853201 12:34391531-34391553 CCACTTCGGGCTGGCCCCCATGG - Intergenic
1096094975 12:48928677-48928699 CAACACCGGCCTGGCCGACATGG - Intronic
1103073522 12:117964075-117964097 CAAGACCAGACTGGCCATCATGG + Intronic
1103118505 12:118360063-118360085 CAACACCGGCCTGGCCAACATGG + Intronic
1104856195 12:131903573-131903595 CAGCTTCAGACAGGCCCTCAGGG - Intronic
1107808162 13:44174331-44174353 CATCTCTGGACATGCCCTCAGGG - Intergenic
1108221034 13:48233378-48233400 CAACTCCGCTCTGGCCCAGAAGG + Exonic
1108918037 13:55640628-55640650 CAAGACCGGACTGGCCAACATGG - Intergenic
1110563356 13:76933531-76933553 CAACACCAGCCTGGCCATCATGG + Intergenic
1112711835 13:102138299-102138321 CAACACAGGAGTGGCCCACAGGG + Intronic
1112711877 13:102138591-102138613 CAACACAGGAGTGGCCCACAGGG + Intronic
1114311709 14:21473675-21473697 CAACACCGGCCTGGCCAACATGG + Intronic
1118132025 14:62977168-62977190 CAAGACCAGACTGGCCATCATGG + Intronic
1120866728 14:89301565-89301587 CAAGACCAGACTGGCCATCATGG + Intronic
1120989312 14:90361272-90361294 CAACACCAGCCTGGCCATCATGG - Intergenic
1122901427 14:104783850-104783872 CAACCCCGGCCTGGGCCTCAGGG + Intronic
1128923021 15:71629437-71629459 CAGCTGCGGAAAGGCCCTCAGGG - Intronic
1129786345 15:78312725-78312747 CATCTCAGAACTGTCCCTCAGGG - Intergenic
1131321692 15:91399880-91399902 CAATGCCAGGCTGGCCCTCATGG - Intergenic
1132540823 16:508572-508594 CAACACCGGCCTGGCCAACATGG - Intronic
1132866064 16:2093316-2093338 CCACTCCTGCCTGGCCCTGAAGG - Intronic
1133130443 16:3673389-3673411 CAGCTCCTGTCTGGCCCTCGTGG + Intronic
1133945073 16:10341149-10341171 CAAGACCAGACTGGCCCACATGG + Intronic
1135529247 16:23238536-23238558 CAACACCGGCCTGGCCAACATGG + Intergenic
1135712592 16:24730038-24730060 CAACCCCGGCCTGGCCCCCGCGG - Intronic
1137722609 16:50636255-50636277 CAACTCCGGGCTGGCCTCCAGGG - Exonic
1138269625 16:55685843-55685865 CAACTCCGGACTGGCCCTCATGG - Intronic
1141198798 16:81881850-81881872 CAACACCAGACTGGCCAACATGG - Intronic
1142181311 16:88672162-88672184 CAGCTCCGGGATGGCCCTCGTGG - Intergenic
1143007443 17:3846127-3846149 CAACACCGGACTCCGCCTCAGGG + Exonic
1146994166 17:37303655-37303677 CAAGACCGGCCTGGCCCACATGG + Intronic
1148734835 17:49859454-49859476 CAACAGTGGACTGGCCCTCCGGG + Intergenic
1152657583 17:81527213-81527235 CATCTCCTGAGTGGCCATCATGG - Intergenic
1155400080 18:25428737-25428759 CAAGTCCAGACTGGCCTTTATGG + Intergenic
1157604242 18:48915674-48915696 CAACTCCTGATTGTCCCTGAGGG - Intergenic
1158346696 18:56523469-56523491 TAACTAAGGCCTGGCCCTCATGG + Intergenic
1160993474 19:1871295-1871317 CACCTCCGGACAGGCCTGCAGGG + Intergenic
1162837615 19:13331435-13331457 CAAGACCGGCCTGGCCATCATGG - Intronic
1163863131 19:19752917-19752939 CATCCCAGGACTGGTCCTCAGGG - Intergenic
1165948303 19:39458401-39458423 CAGCCCCGGTCTGGCCCTGAGGG + Intronic
1167268921 19:48497553-48497575 CACCTCCGGCCTGGCTCTCGGGG + Exonic
1167782229 19:51606200-51606222 AAACTCGCAACTGGCCCTCAAGG + Intergenic
1167947084 19:52996871-52996893 CAACACCAGCCTGGCCATCATGG + Intergenic
925740385 2:7000393-7000415 GAACACGGGATTGGCCCTCATGG - Intronic
925878776 2:8333299-8333321 CAACTCAGGCCTGGCACACAGGG + Intergenic
930318775 2:49828558-49828580 CCACTCAGGAGTGGCCCTGAGGG - Intergenic
932716191 2:74101894-74101916 CAACCACGGGCTGGCCCTCTGGG + Exonic
937999340 2:127719845-127719867 CAAGGCCCGCCTGGCCCTCAGGG - Exonic
940227780 2:151418403-151418425 CAACTCCAGACTGGCCAACGTGG - Intronic
941312860 2:163955727-163955749 CTCCTCCAGACTGCCCCTCAAGG - Intergenic
943250723 2:185518604-185518626 CAACTCCAGCCAGGGCCTCAGGG - Intergenic
1168795334 20:607361-607383 CAACTCCAGACTGGCCAGGATGG + Intronic
1168933504 20:1644250-1644272 CAACTCCAGCCTGGGGCTCAGGG - Intronic
1171412530 20:24956780-24956802 CAACCCCAGCCTGGCCCTCTGGG - Intronic
1171459131 20:25288703-25288725 CCACTGGGGACTGGCCCTCTAGG - Intronic
1173959908 20:47062844-47062866 CAACTCCGGAGTGGGGCTGAAGG + Intronic
1174807964 20:53620986-53621008 CAAGACCAGCCTGGCCCTCATGG - Intergenic
1175402902 20:58710775-58710797 CACCTCCAGACTGGCCGTGAGGG + Intronic
1178097979 21:29235887-29235909 CTTCTCCCGACTGCCCCTCAGGG - Intronic
1179072735 21:38087481-38087503 CAAGACCGGACTGGCCAACATGG - Intronic
1179390919 21:40990462-40990484 CAGCGCTGGACTAGCCCTCATGG - Intergenic
1179801114 21:43811867-43811889 CGCCTCCAGACTGGCCCTCCAGG - Intergenic
1184996169 22:48209244-48209266 CATCCCCGGCCTGGCCCTCCCGG + Intergenic
1203294970 22_KI270736v1_random:33129-33151 CAACTCTGTACTGGGCCCCATGG + Intergenic
950359515 3:12440708-12440730 CAACACTGGACAGGTCCTCATGG - Intergenic
952963827 3:38609055-38609077 TAACTTCAGAATGGCCCTCAGGG + Intronic
953234260 3:41092416-41092438 CAATTCCTGACTGGCCCTGAAGG - Intergenic
954021292 3:47744343-47744365 CGAGTCCAGACTGGCCATCATGG - Intronic
955818623 3:62874166-62874188 CAACTCCGGGCCCGCCCTCCTGG - Intronic
956155042 3:66286861-66286883 CAACACCAGACTGGCCAACATGG - Intronic
959289074 3:104449634-104449656 CAGCTCTAGGCTGGCCCTCAGGG + Intergenic
960771869 3:121201954-121201976 CAACACCGGCCTGGCCAACATGG - Intronic
964714797 3:159710825-159710847 CTACTCCTGACTGGGTCTCATGG - Intronic
966242958 3:177774993-177775015 CACCTCTAGCCTGGCCCTCAGGG - Intergenic
966839258 3:184075514-184075536 CAGCTCCGGCCTGGCCAACATGG - Intergenic
973320213 4:48802514-48802536 CAACACCAGACTGGCCAACATGG + Intergenic
975645784 4:76544595-76544617 CAACACCAGACTGGCCAACATGG - Intronic
977584110 4:98756833-98756855 CAACACCGGCCTGGCCAACATGG - Intergenic
978421547 4:108538473-108538495 CAAGTCCAGACTGGCCAACATGG + Intergenic
981093069 4:140753292-140753314 CAAATCCGGACTGGGCAACATGG - Intronic
983983472 4:174028085-174028107 CAGCTCTAGACTGGCCTTCAAGG - Intergenic
985664048 5:1172523-1172545 CTACTCCGGACTGACTCTCCCGG - Intergenic
987104939 5:14629291-14629313 CAATTCCAGACTGACCCACATGG - Intergenic
988160149 5:27508894-27508916 CAACTCCAGCCTGGCCAACATGG - Intergenic
989100401 5:37817948-37817970 CAAATCCACACTGGCCCTAAAGG + Intronic
990480782 5:56208622-56208644 CAAGACCGGACTGGCCAACATGG - Intronic
994144366 5:96376639-96376661 CAAGACCGGCCTGGCCCACATGG - Intergenic
1000263491 5:159612581-159612603 CAAGACCGGACTGGCCAACATGG + Intergenic
1003306645 6:4934981-4935003 CAACTCCTGAGTGTCCCACAGGG + Intronic
1005754304 6:28911799-28911821 CAACTACAGACTGGCTCTCATGG + Intronic
1007050008 6:38817582-38817604 CCACTCAGGAGTGGCCCTAAAGG + Intronic
1012450404 6:99348925-99348947 CAACTCTAAACTGCCCCTCACGG + Intronic
1013159322 6:107526151-107526173 CAAGACCGGACTGGCCAACATGG - Intronic
1013212369 6:107998660-107998682 CAAGACCAGACTGGCCCACATGG + Intergenic
1017400464 6:154055185-154055207 CAAGACCGGCCTGGCCATCATGG + Intronic
1019055774 6:169222271-169222293 CTACTCCGGCGTGTCCCTCAAGG - Exonic
1023805768 7:43871970-43871992 CAGCTCCCAAGTGGCCCTCAAGG + Intronic
1024291937 7:47811355-47811377 CAACACCGGCCTGGCCAACATGG - Intronic
1026992670 7:74596122-74596144 CAAGTCCAGACTGGCCAACATGG + Intronic
1035484413 7:159211569-159211591 CAACTCGGCCCTGGCCCTCTGGG + Intergenic
1039267534 8:35841870-35841892 CAGCACCTGGCTGGCCCTCATGG + Intergenic
1046320812 8:112571666-112571688 CAACACCAGACTGGCCAACATGG + Intronic
1049438214 8:142597393-142597415 CAGCTCTGGACTGTCCATCAGGG + Intergenic
1049935981 9:502724-502746 CAACACCGGCCTGGCCAACATGG - Intronic
1051122318 9:13764692-13764714 CAGCTCTGGCCTGGCCTTCAGGG + Intergenic
1052341536 9:27368870-27368892 CAACTCAGAAGTGGCGCTCAGGG - Intronic
1052832644 9:33228649-33228671 CCTCTCCTGTCTGGCCCTCAAGG - Intronic
1054712130 9:68522052-68522074 CAAGGCCGGCCTGGCCCACATGG + Intronic
1057911878 9:99025906-99025928 CAACTCCAGGCTGTCCCTCAGGG - Exonic
1059184986 9:112260107-112260129 CAACTCCAGCCTGGCCAACATGG - Intronic
1060983393 9:127806576-127806598 CAGCCCTGGGCTGGCCCTCAAGG - Intronic
1190724672 X:53181016-53181038 CAACACCAGTCTGGCCCACATGG - Intergenic
1190760828 X:53436717-53436739 CAACACCAGACTGGCCAACATGG - Intergenic
1197049533 X:122042369-122042391 CAACTCCAGACAGGGGCTCAGGG - Intergenic
1197607079 X:128597345-128597367 CAACTCCAGACAGGGGCTCAGGG - Intergenic
1199297003 X:146170731-146170753 CAACTGCAAACTGGCCATCACGG - Intergenic
1200329691 X:155282862-155282884 CAGCTCCAGGCTGGCCCCCATGG + Intronic
1201228054 Y:11836838-11836860 CAACTCAGGGCTGGCCTGCAAGG + Intergenic