ID: 1138271151

View in Genome Browser
Species Human (GRCh38)
Location 16:55696736-55696758
Sequence CTGTGGAAGGCTGAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130131
Summary {0: 3, 1: 79, 2: 2744, 3: 32920, 4: 94385}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138271145_1138271151 -8 Left 1138271145 16:55696721-55696743 CCTATAATCCCAGGGCTGTGGAA 0: 1
1: 4
2: 150
3: 3782
4: 57941
Right 1138271151 16:55696736-55696758 CTGTGGAAGGCTGAGGTGGAAGG 0: 3
1: 79
2: 2744
3: 32920
4: 94385
1138271141_1138271151 11 Left 1138271141 16:55696702-55696724 CCAGGCATGGTGGCTCACTCCTA 0: 43
1: 1962
2: 21178
3: 73114
4: 155346
Right 1138271151 16:55696736-55696758 CTGTGGAAGGCTGAGGTGGAAGG 0: 3
1: 79
2: 2744
3: 32920
4: 94385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138271151 Original CRISPR CTGTGGAAGGCTGAGGTGGA AGG Intronic
Too many off-targets to display for this crispr