ID: 1138273067

View in Genome Browser
Species Human (GRCh38)
Location 16:55710005-55710027
Sequence CTGGGCCTTCTCTGGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138273067_1138273074 -6 Left 1138273067 16:55710005-55710027 CCCTGTCCCCAGAGAAGGCCCAG No data
Right 1138273074 16:55710022-55710044 GCCCAGCAAGGGTCACAGCCTGG No data
1138273067_1138273077 4 Left 1138273067 16:55710005-55710027 CCCTGTCCCCAGAGAAGGCCCAG No data
Right 1138273077 16:55710032-55710054 GGTCACAGCCTGGAATGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138273067 Original CRISPR CTGGGCCTTCTCTGGGGACA GGG (reversed) Intergenic
No off target data available for this crispr