ID: 1138274337

View in Genome Browser
Species Human (GRCh38)
Location 16:55721361-55721383
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138274334_1138274337 22 Left 1138274334 16:55721316-55721338 CCAGTCACTATTTTTATGTCAGA No data
Right 1138274337 16:55721361-55721383 TCTATTAAGAAGGACAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138274337 Original CRISPR TCTATTAAGAAGGACAAAGA AGG Intergenic
No off target data available for this crispr