ID: 1138275001

View in Genome Browser
Species Human (GRCh38)
Location 16:55727978-55728000
Sequence CTCACGACATTGTAGTGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138275001_1138275006 25 Left 1138275001 16:55727978-55728000 CCTACCCACTACAATGTCGTGAG No data
Right 1138275006 16:55728026-55728048 GGCTTAAACCTCCCAGTCCAAGG No data
1138275001_1138275004 4 Left 1138275001 16:55727978-55728000 CCTACCCACTACAATGTCGTGAG No data
Right 1138275004 16:55728005-55728027 TAAATATCAAGTCCATTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138275001 Original CRISPR CTCACGACATTGTAGTGGGT AGG (reversed) Intergenic
No off target data available for this crispr