ID: 1138276904

View in Genome Browser
Species Human (GRCh38)
Location 16:55741649-55741671
Sequence ACCCAACCCCATTTCCTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138276904_1138276907 -3 Left 1138276904 16:55741649-55741671 CCCTCAAGGAAATGGGGTTGGGT No data
Right 1138276907 16:55741669-55741691 GGTGGTAAATTCCATCCCAAAGG No data
1138276904_1138276912 23 Left 1138276904 16:55741649-55741671 CCCTCAAGGAAATGGGGTTGGGT No data
Right 1138276912 16:55741695-55741717 GAGAAAGTGTTCATCATTGCAGG No data
1138276904_1138276908 -2 Left 1138276904 16:55741649-55741671 CCCTCAAGGAAATGGGGTTGGGT No data
Right 1138276908 16:55741670-55741692 GTGGTAAATTCCATCCCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138276904 Original CRISPR ACCCAACCCCATTTCCTTGA GGG (reversed) Intergenic