ID: 1138276905

View in Genome Browser
Species Human (GRCh38)
Location 16:55741650-55741672
Sequence CACCCAACCCCATTTCCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138276905_1138276912 22 Left 1138276905 16:55741650-55741672 CCTCAAGGAAATGGGGTTGGGTG No data
Right 1138276912 16:55741695-55741717 GAGAAAGTGTTCATCATTGCAGG No data
1138276905_1138276908 -3 Left 1138276905 16:55741650-55741672 CCTCAAGGAAATGGGGTTGGGTG No data
Right 1138276908 16:55741670-55741692 GTGGTAAATTCCATCCCAAAGGG No data
1138276905_1138276907 -4 Left 1138276905 16:55741650-55741672 CCTCAAGGAAATGGGGTTGGGTG No data
Right 1138276907 16:55741669-55741691 GGTGGTAAATTCCATCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138276905 Original CRISPR CACCCAACCCCATTTCCTTG AGG (reversed) Intergenic
No off target data available for this crispr