ID: 1138276905 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:55741650-55741672 |
Sequence | CACCCAACCCCATTTCCTTG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1138276905_1138276912 | 22 | Left | 1138276905 | 16:55741650-55741672 | CCTCAAGGAAATGGGGTTGGGTG | No data | ||
Right | 1138276912 | 16:55741695-55741717 | GAGAAAGTGTTCATCATTGCAGG | No data | ||||
1138276905_1138276908 | -3 | Left | 1138276905 | 16:55741650-55741672 | CCTCAAGGAAATGGGGTTGGGTG | No data | ||
Right | 1138276908 | 16:55741670-55741692 | GTGGTAAATTCCATCCCAAAGGG | No data | ||||
1138276905_1138276907 | -4 | Left | 1138276905 | 16:55741650-55741672 | CCTCAAGGAAATGGGGTTGGGTG | No data | ||
Right | 1138276907 | 16:55741669-55741691 | GGTGGTAAATTCCATCCCAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1138276905 | Original CRISPR | CACCCAACCCCATTTCCTTG AGG (reversed) | Intergenic | ||