ID: 1138276907

View in Genome Browser
Species Human (GRCh38)
Location 16:55741669-55741691
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138276905_1138276907 -4 Left 1138276905 16:55741650-55741672 CCTCAAGGAAATGGGGTTGGGTG No data
Right 1138276907 16:55741669-55741691 GGTGGTAAATTCCATCCCAAAGG No data
1138276904_1138276907 -3 Left 1138276904 16:55741649-55741671 CCCTCAAGGAAATGGGGTTGGGT No data
Right 1138276907 16:55741669-55741691 GGTGGTAAATTCCATCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138276907 Original CRISPR GGTGGTAAATTCCATCCCAA AGG Intergenic