ID: 1138276912

View in Genome Browser
Species Human (GRCh38)
Location 16:55741695-55741717
Sequence GAGAAAGTGTTCATCATTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138276909_1138276912 -8 Left 1138276909 16:55741680-55741702 CCATCCCAAAGGGCAGAGAAAGT No data
Right 1138276912 16:55741695-55741717 GAGAAAGTGTTCATCATTGCAGG No data
1138276905_1138276912 22 Left 1138276905 16:55741650-55741672 CCTCAAGGAAATGGGGTTGGGTG No data
Right 1138276912 16:55741695-55741717 GAGAAAGTGTTCATCATTGCAGG No data
1138276904_1138276912 23 Left 1138276904 16:55741649-55741671 CCCTCAAGGAAATGGGGTTGGGT No data
Right 1138276912 16:55741695-55741717 GAGAAAGTGTTCATCATTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138276912 Original CRISPR GAGAAAGTGTTCATCATTGC AGG Intergenic
No off target data available for this crispr