ID: 1138279880

View in Genome Browser
Species Human (GRCh38)
Location 16:55764634-55764656
Sequence GGCTGGACCCAGATTCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138279880_1138279886 21 Left 1138279880 16:55764634-55764656 CCACCTGGAATCTGGGTCCAGCC No data
Right 1138279886 16:55764678-55764700 ATTTCTTCTCCATATCCAGCAGG 0: 1
1: 0
2: 2
3: 26
4: 209
1138279880_1138279887 22 Left 1138279880 16:55764634-55764656 CCACCTGGAATCTGGGTCCAGCC No data
Right 1138279887 16:55764679-55764701 TTTCTTCTCCATATCCAGCAGGG 0: 1
1: 0
2: 4
3: 27
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138279880 Original CRISPR GGCTGGACCCAGATTCCAGG TGG (reversed) Intergenic
No off target data available for this crispr